ID: 1056482121

View in Genome Browser
Species Human (GRCh38)
Location 9:87016262-87016284
Sequence GCCACCTTCAGAATAGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056482121_1056482130 26 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482130 9:87016311-87016333 ATGGGGTGTGAAAGAAGGGGAGG No data
1056482121_1056482128 22 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482128 9:87016307-87016329 CAAGATGGGGTGTGAAAGAAGGG No data
1056482121_1056482124 7 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482124 9:87016292-87016314 GTTTGCTGAGGGATTCAAGATGG No data
1056482121_1056482132 28 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482132 9:87016313-87016335 GGGGTGTGAAAGAAGGGGAGGGG No data
1056482121_1056482127 21 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482127 9:87016306-87016328 TCAAGATGGGGTGTGAAAGAAGG No data
1056482121_1056482131 27 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482131 9:87016312-87016334 TGGGGTGTGAAAGAAGGGGAGGG No data
1056482121_1056482129 23 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482129 9:87016308-87016330 AAGATGGGGTGTGAAAGAAGGGG No data
1056482121_1056482126 9 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482126 9:87016294-87016316 TTGCTGAGGGATTCAAGATGGGG No data
1056482121_1056482125 8 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482125 9:87016293-87016315 TTTGCTGAGGGATTCAAGATGGG No data
1056482121_1056482122 -5 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482122 9:87016280-87016302 GTGGCACTAACAGTTTGCTGAGG No data
1056482121_1056482123 -4 Left 1056482121 9:87016262-87016284 CCTGGATCTATTCTGAAGGTGGC No data
Right 1056482123 9:87016281-87016303 TGGCACTAACAGTTTGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056482121 Original CRISPR GCCACCTTCAGAATAGATCC AGG (reversed) Intergenic
No off target data available for this crispr