ID: 1056492379

View in Genome Browser
Species Human (GRCh38)
Location 9:87120307-87120329
Sequence TTCTCTATGAAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056492369_1056492379 23 Left 1056492369 9:87120261-87120283 CCCAGAGAGCACTTCCCTGAGAG No data
Right 1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG No data
1056492370_1056492379 22 Left 1056492370 9:87120262-87120284 CCAGAGAGCACTTCCCTGAGAGG No data
Right 1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG No data
1056492375_1056492379 8 Left 1056492375 9:87120276-87120298 CCTGAGAGGGGCATGAGTTGTTC No data
Right 1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG No data
1056492374_1056492379 9 Left 1056492374 9:87120275-87120297 CCCTGAGAGGGGCATGAGTTGTT No data
Right 1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056492379 Original CRISPR TTCTCTATGAAGAAGCAGGA GGG Intergenic
No off target data available for this crispr