ID: 1056496125

View in Genome Browser
Species Human (GRCh38)
Location 9:87157125-87157147
Sequence GGGGACTAGCAAGTACCCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056496125 Original CRISPR GGGGACTAGCAAGTACCCTC TGG Exonic
911825964 1:102485655-102485677 TGGGACTGGCAATTACCCTCTGG - Intergenic
915013336 1:152710464-152710486 GGGCACTAGCATGCACCCTTGGG + Intergenic
917003467 1:170386121-170386143 TGGGATTGGCAATTACCCTCTGG + Intergenic
920091833 1:203459440-203459462 TGGGATCAGCAAATACCCTCGGG + Intergenic
922344513 1:224685073-224685095 GGGTATTTGCAAGTACCCTCTGG + Intronic
1068956230 10:62820269-62820291 GGGGTCCAGCTAGGACCCTCAGG - Intronic
1074160317 10:110831310-110831332 GGGGAATGGCAAGTAACCTGTGG - Intronic
1074701881 10:116099485-116099507 GGGCAATAGCAATTAACCTCTGG + Intronic
1078615363 11:12860361-12860383 GGGGGCTAGAAAGTACCCCTAGG - Intronic
1078921222 11:15832434-15832456 GGGGAATAGCAACTACCCAAGGG - Intergenic
1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG + Intronic
1097569083 12:61308598-61308620 TGGGACAGGCAAGTTCCCTCTGG + Intergenic
1097927119 12:65141158-65141180 GGGAGCTAGCTAGTTCCCTCGGG + Intergenic
1108249018 13:48546191-48546213 GGGGACCAGCAGGTTCCCTGAGG - Intergenic
1110597942 13:77339537-77339559 GGTTACTAGCAAGTATACTCAGG - Intergenic
1118956546 14:70488338-70488360 TGGGACTAGCAGTTCCCCTCTGG - Intergenic
1119388837 14:74276511-74276533 TGGGGCTAGCAAGGAGCCTCAGG - Intergenic
1120940485 14:89943377-89943399 TGGGACTGGCATGTACCATCAGG + Intronic
1122614476 14:103007716-103007738 GGGGACTGCCAAGTGCCTTCTGG + Intronic
1123627689 15:22238915-22238937 GGGGACTAACAAGCAGCCTCTGG - Intergenic
1125628527 15:41129101-41129123 AGAGACCAGCAAGGACCCTCAGG + Intergenic
1132586184 16:706567-706589 GGAGCCTGGCAAGTTCCCTCGGG + Intronic
1141170370 16:81687074-81687096 GGGGACTAGCAAGTGCCACCAGG - Intronic
1141893936 16:86946672-86946694 GGGCCCCAGCAGGTACCCTCGGG + Intergenic
1141976266 16:87518438-87518460 GGGGACTAACAAGCAGCCTCTGG + Intergenic
1157453586 18:47806472-47806494 AGGGGCTAGTGAGTACCCTCAGG + Intergenic
1161301356 19:3544515-3544537 AGGGACTTGCAAGGACCCCCTGG - Exonic
1161491867 19:4566721-4566743 GGGGACTTGCATGTACTCTGTGG + Intergenic
1161578629 19:5068406-5068428 GGGGACCAGAAGGTAGCCTCGGG - Intronic
1165070025 19:33249597-33249619 GGGGACTAGGAAGTCCTCTAGGG - Intergenic
1168633070 19:57972373-57972395 GGTGACCAGCCAGCACCCTCTGG + Intronic
930139607 2:47938541-47938563 GAGGACTGGTAAGTACCCCCAGG - Intergenic
938971927 2:136440404-136440426 GGGGACTTGCAAGTACAGGCTGG + Intergenic
948469352 2:238167312-238167334 GGAGACTAGCAGGTGCCCCCAGG - Intronic
1169663686 20:8009448-8009470 TGTGATTAGCAAGTAACCTCTGG - Intronic
1172448269 20:35004257-35004279 GAGGGCTCGCAAGTGCCCTCAGG - Intronic
1174525783 20:51170043-51170065 GTGGATTGGCGAGTACCCTCAGG + Intergenic
1179157423 21:38862611-38862633 GGGGGTTAGAAAGTACCCTGTGG + Intergenic
1179442229 21:41403352-41403374 GGTGACTAGCAAGTGAACTCTGG - Intronic
1183435256 22:37790414-37790436 GAGGATTAGCAAATGCCCTCAGG + Intergenic
1184675939 22:46043605-46043627 GGGGAGTGGACAGTACCCTCAGG + Intergenic
950555029 3:13690158-13690180 GGGGTCTAGCAGGTGCCCACAGG - Intergenic
952867539 3:37863776-37863798 AGGAACCAGCAGGTACCCTCAGG + Intronic
954966277 3:54613951-54613973 CAGGAGTAGCAAGTACCATCAGG - Intronic
955633419 3:60999941-60999963 AGGGACTAGCAAGCTCCCTGGGG + Intronic
957269311 3:78008836-78008858 GGGTAGTAGCAAGTACTATCCGG + Intergenic
957432711 3:80133381-80133403 GGGGATTAGTGAGTACCCTCAGG - Intergenic
968817557 4:2829707-2829729 GGGGGGTAGCAGGTACCCTGGGG - Exonic
968900499 4:3429361-3429383 GTGGACTGGCAAGTACGCCCTGG - Intronic
972104246 4:35462300-35462322 TGGGATTAGCAATTCCCCTCTGG + Intergenic
984141520 4:176009974-176009996 GAGGACTGGCAAGTTCCCTTCGG + Intergenic
984752742 4:183294605-183294627 GGGGACTAGGAAGGAGCCTCTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993701424 5:91123457-91123479 GGGGGCTAACAAGCTCCCTCAGG + Intronic
997631371 5:135371564-135371586 GGGAACTAGGAAGTACCCTTTGG + Intronic
1003511623 6:6785950-6785972 TGGGACTGGCAATTACACTCTGG + Intergenic
1016246597 6:141989071-141989093 GGGAACTAGCAAGTTCCAACAGG + Intergenic
1018058473 6:160071648-160071670 GGGGACCAGGAAGCTCCCTCAGG - Intronic
1020245265 7:6424480-6424502 GGGGTCAAGCAGGTGCCCTCTGG + Intronic
1027628565 7:80574811-80574833 GGGCACACGCAAGTACACTCTGG + Intronic
1028826623 7:95281140-95281162 GGATACTAGCAAGTACCCAGGGG + Intronic
1034447316 7:151120288-151120310 GGGCACCGGCAAGGACCCTCGGG - Intronic
1035925849 8:3726726-3726748 CTGGACTGGCAAGTTCCCTCTGG - Intronic
1036936108 8:13004124-13004146 TGGGACCAGCAATTCCCCTCTGG - Intronic
1037839326 8:22232599-22232621 TGGGTCTGGCAAGAACCCTCTGG + Intergenic
1037917769 8:22783024-22783046 GGTGCCTGGCCAGTACCCTCTGG - Intronic
1042023247 8:64394004-64394026 TGGGACTAGGAAGTAACCCCAGG - Intergenic
1047700442 8:127444268-127444290 AGGGCCTAGCTAGTTCCCTCTGG - Intergenic
1048991562 8:139763429-139763451 GGGGACTAACATGTCCCCACGGG - Intronic
1051313030 9:15796897-15796919 GGTGACTAGCAAGCACCCAGAGG + Intronic
1051923900 9:22299690-22299712 TGGGATTAGCAATTCCCCTCTGG + Intergenic
1055111348 9:72563135-72563157 GGAGAATAGCAAGTACTCTGGGG + Intronic
1056244107 9:84677258-84677280 GGGGAATAATAAGTACTCTCTGG - Intronic
1056496125 9:87157125-87157147 GGGGACTAGCAAGTACCCTCTGG + Exonic
1188210527 X:27418845-27418867 TGGGACTGGCAATTCCCCTCTGG - Intergenic
1189297142 X:39926796-39926818 CGTGACTAGAAAATACCCTCAGG + Intergenic
1192328109 X:70150691-70150713 GGTGACTTGCCAGTACCTTCAGG - Intronic
1193088303 X:77467498-77467520 TGGGATCAGCAAGTCCCCTCTGG - Intergenic
1193147599 X:78093265-78093287 TGGGACTGGCAATTCCCCTCTGG + Intronic
1193488411 X:82116065-82116087 TGGGATTAGCAATTCCCCTCTGG + Intergenic