ID: 1056499065

View in Genome Browser
Species Human (GRCh38)
Location 9:87190179-87190201
Sequence GAGTCACTGCACCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499068 2 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499068 9:87190204-87190226 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1056499065_1056499074 14 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499074 9:87190216-87190238 AGCACTTTGGGAGGCCAAGGTGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1056499065_1056499075 15 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499075 9:87190217-87190239 GCACTTTGGGAGGCCAAGGTGGG 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
1056499065_1056499076 18 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499076 9:87190220-87190242 CTTTGGGAGGCCAAGGTGGGAGG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
1056499065_1056499072 11 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499072 9:87190213-87190235 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1056499065_1056499067 1 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499067 9:87190203-87190225 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1056499065_1056499070 5 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499070 9:87190207-87190229 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499065 Original CRISPR GAGTCACTGCACCTGGACAC AGG (reversed) Intergenic
No off target data available for this crispr