ID: 1056499067

View in Genome Browser
Species Human (GRCh38)
Location 9:87190203-87190225
Sequence CACCTGTAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 901149
Summary {0: 68945, 1: 203244, 2: 249087, 3: 204446, 4: 175427}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499067 1 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499067 9:87190203-87190225 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1056499063_1056499067 14 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499067 9:87190203-87190225 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1056499066_1056499067 -6 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499067 9:87190203-87190225 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499067 Original CRISPR CACCTGTAATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr