ID: 1056499068

View in Genome Browser
Species Human (GRCh38)
Location 9:87190204-87190226
Sequence ACCTGTAATCCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 943540
Summary {0: 71908, 1: 300079, 2: 246221, 3: 151210, 4: 174122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499068 2 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499068 9:87190204-87190226 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1056499066_1056499068 -5 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499068 9:87190204-87190226 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1056499063_1056499068 15 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499068 9:87190204-87190226 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499068 Original CRISPR ACCTGTAATCCCAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr