ID: 1056499070

View in Genome Browser
Species Human (GRCh38)
Location 9:87190207-87190229
Sequence TGTAATCCCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499070 5 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499070 9:87190207-87190229 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1056499066_1056499070 -2 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499070 9:87190207-87190229 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1056499063_1056499070 18 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499070 9:87190207-87190229 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499070 Original CRISPR TGTAATCCCAGCACTTTGGG AGG Intergenic
Too many off-targets to display for this crispr