ID: 1056499072

View in Genome Browser
Species Human (GRCh38)
Location 9:87190213-87190235
Sequence CCCAGCACTTTGGGAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 763604
Summary {0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499063_1056499072 24 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499072 9:87190213-87190235 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1056499065_1056499072 11 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499072 9:87190213-87190235 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1056499066_1056499072 4 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499072 9:87190213-87190235 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499072 Original CRISPR CCCAGCACTTTGGGAGGCCA AGG Intergenic
Too many off-targets to display for this crispr