ID: 1056499074

View in Genome Browser
Species Human (GRCh38)
Location 9:87190216-87190238
Sequence AGCACTTTGGGAGGCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 511305
Summary {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499074 14 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499074 9:87190216-87190238 AGCACTTTGGGAGGCCAAGGTGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1056499063_1056499074 27 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499074 9:87190216-87190238 AGCACTTTGGGAGGCCAAGGTGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1056499066_1056499074 7 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499074 9:87190216-87190238 AGCACTTTGGGAGGCCAAGGTGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499074 Original CRISPR AGCACTTTGGGAGGCCAAGG TGG Intergenic
Too many off-targets to display for this crispr