ID: 1056499075

View in Genome Browser
Species Human (GRCh38)
Location 9:87190217-87190239
Sequence GCACTTTGGGAGGCCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 733858
Summary {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499066_1056499075 8 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499075 9:87190217-87190239 GCACTTTGGGAGGCCAAGGTGGG 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
1056499065_1056499075 15 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499075 9:87190217-87190239 GCACTTTGGGAGGCCAAGGTGGG 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
1056499063_1056499075 28 Left 1056499063 9:87190166-87190188 CCTAAAATATGTTCCTGTGTCCA No data
Right 1056499075 9:87190217-87190239 GCACTTTGGGAGGCCAAGGTGGG 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499075 Original CRISPR GCACTTTGGGAGGCCAAGGT GGG Intergenic
Too many off-targets to display for this crispr