ID: 1056499076

View in Genome Browser
Species Human (GRCh38)
Location 9:87190220-87190242
Sequence CTTTGGGAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 533845
Summary {0: 21198, 1: 71365, 2: 150513, 3: 157804, 4: 132965}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056499065_1056499076 18 Left 1056499065 9:87190179-87190201 CCTGTGTCCAGGTGCAGTGACTC No data
Right 1056499076 9:87190220-87190242 CTTTGGGAGGCCAAGGTGGGAGG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
1056499069_1056499076 -8 Left 1056499069 9:87190205-87190227 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1056499076 9:87190220-87190242 CTTTGGGAGGCCAAGGTGGGAGG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
1056499066_1056499076 11 Left 1056499066 9:87190186-87190208 CCAGGTGCAGTGACTCACACCTG 0: 234
1: 6221
2: 24940
3: 67132
4: 121436
Right 1056499076 9:87190220-87190242 CTTTGGGAGGCCAAGGTGGGAGG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056499076 Original CRISPR CTTTGGGAGGCCAAGGTGGG AGG Intergenic
Too many off-targets to display for this crispr