ID: 1056504058

View in Genome Browser
Species Human (GRCh38)
Location 9:87239990-87240012
Sequence TATTGGGACCCTTGTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056504058_1056504061 0 Left 1056504058 9:87239990-87240012 CCTGTAAAACAAGGGTCCCAATA No data
Right 1056504061 9:87240013-87240035 CTATCCACCTCATGAGACAGAGG No data
1056504058_1056504062 1 Left 1056504058 9:87239990-87240012 CCTGTAAAACAAGGGTCCCAATA No data
Right 1056504062 9:87240014-87240036 TATCCACCTCATGAGACAGAGGG No data
1056504058_1056504065 9 Left 1056504058 9:87239990-87240012 CCTGTAAAACAAGGGTCCCAATA No data
Right 1056504065 9:87240022-87240044 TCATGAGACAGAGGGTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056504058 Original CRISPR TATTGGGACCCTTGTTTTAC AGG (reversed) Intergenic
No off target data available for this crispr