ID: 1056505490

View in Genome Browser
Species Human (GRCh38)
Location 9:87254300-87254322
Sequence TAGTAAACGTTCAGTAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056505490_1056505493 -5 Left 1056505490 9:87254300-87254322 CCCTGTTTACTGAACGTTTACTA No data
Right 1056505493 9:87254318-87254340 TACTAAGGCCAAGACCTTAGTGG No data
1056505490_1056505498 26 Left 1056505490 9:87254300-87254322 CCCTGTTTACTGAACGTTTACTA No data
Right 1056505498 9:87254349-87254371 GATCAATGGATAAATGCCACAGG No data
1056505490_1056505497 12 Left 1056505490 9:87254300-87254322 CCCTGTTTACTGAACGTTTACTA No data
Right 1056505497 9:87254335-87254357 TAGTGGGTCTGATTGATCAATGG No data
1056505490_1056505494 -4 Left 1056505490 9:87254300-87254322 CCCTGTTTACTGAACGTTTACTA No data
Right 1056505494 9:87254319-87254341 ACTAAGGCCAAGACCTTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056505490 Original CRISPR TAGTAAACGTTCAGTAAACA GGG (reversed) Intergenic
No off target data available for this crispr