ID: 1056508166

View in Genome Browser
Species Human (GRCh38)
Location 9:87277157-87277179
Sequence CTGGGGCCTGCATTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056508166_1056508170 20 Left 1056508166 9:87277157-87277179 CCACAAAAAAATGCAGGCCCCAG No data
Right 1056508170 9:87277200-87277222 AATTGAAACAAAAAAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056508166 Original CRISPR CTGGGGCCTGCATTTTTTTG TGG (reversed) Intergenic
No off target data available for this crispr