ID: 1056511025

View in Genome Browser
Species Human (GRCh38)
Location 9:87305851-87305873
Sequence TTGGGTTGTTTAGAAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056511025_1056511032 13 Left 1056511025 9:87305851-87305873 CCTCCAGCTTCTAAACAACCCAA No data
Right 1056511032 9:87305887-87305909 AAATGCATCATGTCCCACTTTGG No data
1056511025_1056511028 -10 Left 1056511025 9:87305851-87305873 CCTCCAGCTTCTAAACAACCCAA No data
Right 1056511028 9:87305864-87305886 AACAACCCAACATTCCTTATGGG No data
1056511025_1056511033 14 Left 1056511025 9:87305851-87305873 CCTCCAGCTTCTAAACAACCCAA No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056511025 Original CRISPR TTGGGTTGTTTAGAAGCTGG AGG (reversed) Intergenic
No off target data available for this crispr