ID: 1056511028

View in Genome Browser
Species Human (GRCh38)
Location 9:87305864-87305886
Sequence AACAACCCAACATTCCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056511024_1056511028 -5 Left 1056511024 9:87305846-87305868 CCACACCTCCAGCTTCTAAACAA No data
Right 1056511028 9:87305864-87305886 AACAACCCAACATTCCTTATGGG No data
1056511023_1056511028 0 Left 1056511023 9:87305841-87305863 CCAAACCACACCTCCAGCTTCTA No data
Right 1056511028 9:87305864-87305886 AACAACCCAACATTCCTTATGGG No data
1056511022_1056511028 10 Left 1056511022 9:87305831-87305853 CCAGAGATTTCCAAACCACACCT No data
Right 1056511028 9:87305864-87305886 AACAACCCAACATTCCTTATGGG No data
1056511025_1056511028 -10 Left 1056511025 9:87305851-87305873 CCTCCAGCTTCTAAACAACCCAA No data
Right 1056511028 9:87305864-87305886 AACAACCCAACATTCCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056511028 Original CRISPR AACAACCCAACATTCCTTAT GGG Intergenic
No off target data available for this crispr