ID: 1056511033

View in Genome Browser
Species Human (GRCh38)
Location 9:87305888-87305910
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056511029_1056511033 -4 Left 1056511029 9:87305869-87305891 CCCAACATTCCTTATGGGAAATG No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data
1056511026_1056511033 11 Left 1056511026 9:87305854-87305876 CCAGCTTCTAAACAACCCAACAT No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data
1056511024_1056511033 19 Left 1056511024 9:87305846-87305868 CCACACCTCCAGCTTCTAAACAA No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data
1056511030_1056511033 -5 Left 1056511030 9:87305870-87305892 CCAACATTCCTTATGGGAAATGC No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data
1056511023_1056511033 24 Left 1056511023 9:87305841-87305863 CCAAACCACACCTCCAGCTTCTA No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data
1056511025_1056511033 14 Left 1056511025 9:87305851-87305873 CCTCCAGCTTCTAAACAACCCAA No data
Right 1056511033 9:87305888-87305910 AATGCATCATGTCCCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056511033 Original CRISPR AATGCATCATGTCCCACTTT GGG Intergenic
No off target data available for this crispr