ID: 1056511271

View in Genome Browser
Species Human (GRCh38)
Location 9:87308432-87308454
Sequence CTGAAGCTCCAGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056511267_1056511271 -4 Left 1056511267 9:87308413-87308435 CCATTCAGAGTGGAGCAGCCTGA No data
Right 1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG No data
1056511265_1056511271 0 Left 1056511265 9:87308409-87308431 CCCTCCATTCAGAGTGGAGCAGC No data
Right 1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG No data
1056511266_1056511271 -1 Left 1056511266 9:87308410-87308432 CCTCCATTCAGAGTGGAGCAGCC No data
Right 1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056511271 Original CRISPR CTGAAGCTCCAGAAGGAAGT GGG Intergenic
No off target data available for this crispr