ID: 1056513353

View in Genome Browser
Species Human (GRCh38)
Location 9:87327100-87327122
Sequence AGGAAGAAGAAGGATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056513347_1056513353 15 Left 1056513347 9:87327062-87327084 CCAGTCTGGGTGATGGAGCAAGA 0: 12
1: 332
2: 3340
3: 36970
4: 90447
Right 1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG No data
1056513345_1056513353 25 Left 1056513345 9:87327052-87327074 CCACTGCACTCCAGTCTGGGTGA 0: 3347
1: 90407
2: 179275
3: 206110
4: 175571
Right 1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG No data
1056513349_1056513353 -9 Left 1056513349 9:87327086-87327108 CCTGTCTCAACAAGAGGAAGAAG No data
Right 1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056513353 Original CRISPR AGGAAGAAGAAGGATGAGGA GGG Intergenic
No off target data available for this crispr