ID: 1056514824

View in Genome Browser
Species Human (GRCh38)
Location 9:87340285-87340307
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056514824_1056514830 -5 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514830 9:87340303-87340325 CTGGGGTATCAAAAAGAGAAAGG No data
1056514824_1056514833 15 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514833 9:87340323-87340345 AGGAAAAAAGCAAGTGGGCGTGG No data
1056514824_1056514834 29 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data
1056514824_1056514832 10 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514832 9:87340318-87340340 GAGAAAGGAAAAAAGCAAGTGGG No data
1056514824_1056514831 9 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056514824 Original CRISPR CCCAGGTGATGGGAACAGCA AGG (reversed) Intergenic