ID: 1056514828

View in Genome Browser
Species Human (GRCh38)
Location 9:87340296-87340318
Sequence CTTTTTGATACCCCAGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056514828_1056514834 18 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data
1056514828_1056514832 -1 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514832 9:87340318-87340340 GAGAAAGGAAAAAAGCAAGTGGG No data
1056514828_1056514831 -2 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data
1056514828_1056514833 4 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514833 9:87340323-87340345 AGGAAAAAAGCAAGTGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056514828 Original CRISPR CTTTTTGATACCCCAGGTGA TGG (reversed) Intergenic