ID: 1056514830

View in Genome Browser
Species Human (GRCh38)
Location 9:87340303-87340325
Sequence CTGGGGTATCAAAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056514822_1056514830 0 Left 1056514822 9:87340280-87340302 CCTTGCCTTGCTGTTCCCATCAC No data
Right 1056514830 9:87340303-87340325 CTGGGGTATCAAAAAGAGAAAGG No data
1056514824_1056514830 -5 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514830 9:87340303-87340325 CTGGGGTATCAAAAAGAGAAAGG No data
1056514821_1056514830 20 Left 1056514821 9:87340260-87340282 CCTTCATTTTGTTAATTTCACCT No data
Right 1056514830 9:87340303-87340325 CTGGGGTATCAAAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056514830 Original CRISPR CTGGGGTATCAAAAAGAGAA AGG Intergenic