ID: 1056514831

View in Genome Browser
Species Human (GRCh38)
Location 9:87340317-87340339
Sequence AGAGAAAGGAAAAAAGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056514829_1056514831 -8 Left 1056514829 9:87340302-87340324 CCTGGGGTATCAAAAAGAGAAAG No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data
1056514822_1056514831 14 Left 1056514822 9:87340280-87340302 CCTTGCCTTGCTGTTCCCATCAC No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data
1056514828_1056514831 -2 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data
1056514827_1056514831 -1 Left 1056514827 9:87340295-87340317 CCCATCACCTGGGGTATCAAAAA No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data
1056514824_1056514831 9 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514831 9:87340317-87340339 AGAGAAAGGAAAAAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056514831 Original CRISPR AGAGAAAGGAAAAAAGCAAG TGG Intergenic