ID: 1056514834

View in Genome Browser
Species Human (GRCh38)
Location 9:87340337-87340359
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056514828_1056514834 18 Left 1056514828 9:87340296-87340318 CCATCACCTGGGGTATCAAAAAG No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data
1056514824_1056514834 29 Left 1056514824 9:87340285-87340307 CCTTGCTGTTCCCATCACCTGGG No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data
1056514827_1056514834 19 Left 1056514827 9:87340295-87340317 CCCATCACCTGGGGTATCAAAAA No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data
1056514829_1056514834 12 Left 1056514829 9:87340302-87340324 CCTGGGGTATCAAAAAGAGAAAG No data
Right 1056514834 9:87340337-87340359 TGGGCGTGGCAACAATAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056514834 Original CRISPR TGGGCGTGGCAACAATAACT TGG Intergenic
No off target data available for this crispr