ID: 1056516318

View in Genome Browser
Species Human (GRCh38)
Location 9:87353856-87353878
Sequence CAATAGTAACAGATGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056516318_1056516321 8 Left 1056516318 9:87353856-87353878 CCCCAGGGCATCTGTTACTATTG No data
Right 1056516321 9:87353887-87353909 TTTTAATAAATTTACAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056516318 Original CRISPR CAATAGTAACAGATGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr