ID: 1056520007

View in Genome Browser
Species Human (GRCh38)
Location 9:87392235-87392257
Sequence CTGCTTTCATCATTCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056520007_1056520012 -5 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520012 9:87392253-87392275 AGCAGCCCGGGGCTGAGGCATGG No data
1056520007_1056520014 -3 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520014 9:87392255-87392277 CAGCCCGGGGCTGAGGCATGGGG No data
1056520007_1056520011 -10 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520011 9:87392248-87392270 ATGAAAGCAGCCCGGGGCTGAGG No data
1056520007_1056520020 6 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520020 9:87392264-87392286 GCTGAGGCATGGGGGTGGCAGGG No data
1056520007_1056520018 1 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520018 9:87392259-87392281 CCGGGGCTGAGGCATGGGGGTGG No data
1056520007_1056520019 5 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520019 9:87392263-87392285 GGCTGAGGCATGGGGGTGGCAGG No data
1056520007_1056520013 -4 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520013 9:87392254-87392276 GCAGCCCGGGGCTGAGGCATGGG No data
1056520007_1056520015 -2 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520015 9:87392256-87392278 AGCCCGGGGCTGAGGCATGGGGG No data
1056520007_1056520021 10 Left 1056520007 9:87392235-87392257 CCTGTGTGGAATGATGAAAGCAG No data
Right 1056520021 9:87392268-87392290 AGGCATGGGGGTGGCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056520007 Original CRISPR CTGCTTTCATCATTCCACAC AGG (reversed) Intergenic
No off target data available for this crispr