ID: 1056522280

View in Genome Browser
Species Human (GRCh38)
Location 9:87412118-87412140
Sequence AACTGAGGGAAGGGGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056522280_1056522289 -1 Left 1056522280 9:87412118-87412140 CCCCCAAACCCCTTCCCTCAGTT No data
Right 1056522289 9:87412140-87412162 TTCTCCACTCTCTCTTCTCTAGG No data
1056522280_1056522292 19 Left 1056522280 9:87412118-87412140 CCCCCAAACCCCTTCCCTCAGTT No data
Right 1056522292 9:87412160-87412182 AGGCTTGCTTCCTTCACTATGGG 0: 107
1: 98
2: 374
3: 254
4: 247
1056522280_1056522291 18 Left 1056522280 9:87412118-87412140 CCCCCAAACCCCTTCCCTCAGTT No data
Right 1056522291 9:87412159-87412181 TAGGCTTGCTTCCTTCACTATGG 0: 70
1: 81
2: 338
3: 153
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056522280 Original CRISPR AACTGAGGGAAGGGGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr