ID: 1056525070

View in Genome Browser
Species Human (GRCh38)
Location 9:87435545-87435567
Sequence TAGGGTGAACAATTTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056525070_1056525080 24 Left 1056525070 9:87435545-87435567 CCAACTCTAAATTGTTCACCCTA No data
Right 1056525080 9:87435592-87435614 AAGGCTCTGCATGGTGGCACAGG No data
1056525070_1056525074 5 Left 1056525070 9:87435545-87435567 CCAACTCTAAATTGTTCACCCTA No data
Right 1056525074 9:87435573-87435595 CCTGCAAGAAACCCCAATAAAGG No data
1056525070_1056525075 15 Left 1056525070 9:87435545-87435567 CCAACTCTAAATTGTTCACCCTA No data
Right 1056525075 9:87435583-87435605 ACCCCAATAAAGGCTCTGCATGG No data
1056525070_1056525079 18 Left 1056525070 9:87435545-87435567 CCAACTCTAAATTGTTCACCCTA No data
Right 1056525079 9:87435586-87435608 CCAATAAAGGCTCTGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056525070 Original CRISPR TAGGGTGAACAATTTAGAGT TGG (reversed) Intergenic
No off target data available for this crispr