ID: 1056525777

View in Genome Browser
Species Human (GRCh38)
Location 9:87441744-87441766
Sequence ATGGTTTAGCACCACCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056525777_1056525779 -10 Left 1056525777 9:87441744-87441766 CCAAGAGGGTGGTGCTAAACCAT No data
Right 1056525779 9:87441757-87441779 GCTAAACCATTCATGAAGGAAGG No data
1056525777_1056525781 25 Left 1056525777 9:87441744-87441766 CCAAGAGGGTGGTGCTAAACCAT No data
Right 1056525781 9:87441792-87441814 GATCCAATCACCTCCCACCAAGG 0: 32
1: 72
2: 107
3: 174
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056525777 Original CRISPR ATGGTTTAGCACCACCCTCT TGG (reversed) Intergenic
No off target data available for this crispr