ID: 1056529108

View in Genome Browser
Species Human (GRCh38)
Location 9:87471187-87471209
Sequence CTGTTGGACCCTTTATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056529104_1056529108 -3 Left 1056529104 9:87471167-87471189 CCAACCAGGAGGGTCCATCACTG No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data
1056529098_1056529108 23 Left 1056529098 9:87471141-87471163 CCCAGTGTTCCTTGATTAAGAAT No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data
1056529105_1056529108 -7 Left 1056529105 9:87471171-87471193 CCAGGAGGGTCCATCACTGTTGG No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data
1056529097_1056529108 30 Left 1056529097 9:87471134-87471156 CCATGAGCCCAGTGTTCCTTGAT No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data
1056529099_1056529108 22 Left 1056529099 9:87471142-87471164 CCAGTGTTCCTTGATTAAGAATT No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data
1056529100_1056529108 14 Left 1056529100 9:87471150-87471172 CCTTGATTAAGAATTGTCCAACC No data
Right 1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056529108 Original CRISPR CTGTTGGACCCTTTATCTCC TGG Intergenic
No off target data available for this crispr