ID: 1056529109

View in Genome Browser
Species Human (GRCh38)
Location 9:87471195-87471217
Sequence AGTAACTACCAGGAGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056529109_1056529116 14 Left 1056529109 9:87471195-87471217 CCCTTTATCTCCTGGTAGTTACT No data
Right 1056529116 9:87471232-87471254 GTAGGCAATTTTCTTTCTTCTGG No data
1056529109_1056529113 -8 Left 1056529109 9:87471195-87471217 CCCTTTATCTCCTGGTAGTTACT No data
Right 1056529113 9:87471210-87471232 TAGTTACTCCTAGGCTAAGATGG No data
1056529109_1056529114 -4 Left 1056529109 9:87471195-87471217 CCCTTTATCTCCTGGTAGTTACT No data
Right 1056529114 9:87471214-87471236 TACTCCTAGGCTAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056529109 Original CRISPR AGTAACTACCAGGAGATAAA GGG (reversed) Intergenic
No off target data available for this crispr