ID: 1056535934

View in Genome Browser
Species Human (GRCh38)
Location 9:87527689-87527711
Sequence AACTGTCCAAAGAAAACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 785}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056535934_1056535937 16 Left 1056535934 9:87527689-87527711 CCTAATGTTTTCTTTGGACAGTT 0: 1
1: 0
2: 5
3: 68
4: 785
Right 1056535937 9:87527728-87527750 CTTTCTGAACTGTTACTGGCCGG No data
1056535934_1056535938 24 Left 1056535934 9:87527689-87527711 CCTAATGTTTTCTTTGGACAGTT 0: 1
1: 0
2: 5
3: 68
4: 785
Right 1056535938 9:87527736-87527758 ACTGTTACTGGCCGGATTATTGG No data
1056535934_1056535939 25 Left 1056535934 9:87527689-87527711 CCTAATGTTTTCTTTGGACAGTT 0: 1
1: 0
2: 5
3: 68
4: 785
Right 1056535939 9:87527737-87527759 CTGTTACTGGCCGGATTATTGGG No data
1056535934_1056535936 12 Left 1056535934 9:87527689-87527711 CCTAATGTTTTCTTTGGACAGTT 0: 1
1: 0
2: 5
3: 68
4: 785
Right 1056535936 9:87527724-87527746 GCTTCTTTCTGAACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056535934 Original CRISPR AACTGTCCAAAGAAAACATT AGG (reversed) Intronic
900758224 1:4452379-4452401 AACTACTAAAAGAAAACATTGGG - Intergenic
902119757 1:14153296-14153318 AACTACTAAAAGAAAACATTGGG - Intergenic
903689773 1:25164703-25164725 AACTCTTAAAAGAAAACATAAGG + Intergenic
905987951 1:42304784-42304806 AACTACTAAAAGAAAACATTGGG + Intronic
906977360 1:50589776-50589798 AACTGTTAAAAGAAAACATAGGG - Intronic
908115020 1:60932187-60932209 TACTGTCCAAAGAAGATATCTGG + Intronic
908350096 1:63278288-63278310 AACTGTAAGAATAAAACATTTGG - Intergenic
908362696 1:63384587-63384609 AACTGCTCCAAGAAAACACTGGG - Intronic
908601941 1:65749068-65749090 AACTATTAAAAGAAAACATAAGG + Intergenic
908697223 1:66857276-66857298 AACTGAACAATGAAAACACTTGG + Intronic
909109747 1:71459724-71459746 AATTGTGCAAAGAAATCATTTGG - Intronic
909183732 1:72458301-72458323 AACTACTCAAAGAAAACATTGGG - Intergenic
909204822 1:72742330-72742352 AACTGTCTAAGAAAATCATTTGG - Intergenic
909410726 1:75347919-75347941 AATTGTCAAAAGAAAACCTTGGG + Intronic
909690763 1:78405345-78405367 AACTGGTGGAAGAAAACATTGGG - Intronic
909928456 1:81466820-81466842 AACTTTCCAAAGAAACAATGTGG - Intronic
910030854 1:82720925-82720947 AACTGCTACAAGAAAACATTGGG - Intergenic
910447295 1:87311662-87311684 AACTGGACAAAGAGTACATTTGG + Intergenic
911414311 1:97551793-97551815 AACTGTGCATTGAAAATATTTGG + Intronic
911490445 1:98558935-98558957 AACTGAACAATGAAAACACTTGG + Intergenic
911528838 1:99019298-99019320 ATCTGTCCTAAGAAAATAATTGG + Intergenic
911679314 1:100696075-100696097 AACTGCTAAAAGAAAACACTAGG - Intergenic
911861024 1:102949446-102949468 AACTGTTCAAAGAATACCCTAGG + Intronic
911961336 1:104306974-104306996 AACTACTGAAAGAAAACATTAGG + Intergenic
912024700 1:105154356-105154378 AACTGCTAGAAGAAAACATTGGG - Intergenic
912053402 1:105562146-105562168 AACTGTTATAAGAAAACATAGGG - Intergenic
912644289 1:111377075-111377097 AACTACTAAAAGAAAACATTGGG + Intergenic
912898807 1:113624809-113624831 AACTAAAAAAAGAAAACATTGGG - Intronic
913166241 1:116188721-116188743 AACTACTAAAAGAAAACATTGGG - Intergenic
914436723 1:147667054-147667076 CACTATCAAAAGAAAAGATTTGG - Intronic
915045831 1:153014693-153014715 AGCTCTTCAAAGAAAACATAGGG - Intergenic
915857309 1:159403152-159403174 AACTGCTACAAGAAAACATTGGG + Intergenic
916145386 1:161734555-161734577 AGCTGTCCAAAGATAAGAGTGGG - Intergenic
916187924 1:162151060-162151082 AACTGTTAAAAGAAAATGTTGGG - Intronic
916219679 1:162431505-162431527 AACTCTCCAATGAAGGCATTTGG - Intergenic
916332772 1:163636676-163636698 AACTGTCCAGAGTGACCATTTGG + Intergenic
916617881 1:166461724-166461746 AACTTGCCAAAGAAGTCATTTGG + Intergenic
917320543 1:173776521-173776543 AACTGCTAAAAGAAAACACTGGG - Intronic
917921277 1:179752341-179752363 AACTTTCAGAAGAAAACATAGGG + Intronic
917933481 1:179840684-179840706 AATTGAACAAAGAAAACACTTGG + Exonic
917953362 1:180064593-180064615 AAGTTTGTAAAGAAAACATTTGG - Intronic
919013094 1:191990959-191990981 AACTGTTACAAGAAAACATTGGG + Intergenic
919146953 1:193647654-193647676 AACTATTAAAAGAAAACACTGGG - Intergenic
919721150 1:200837354-200837376 AGCTGACCAAAGCAAACAATGGG - Intronic
921384330 1:214553343-214553365 GGGTTTCCAAAGAAAACATTAGG + Intergenic
921747690 1:218755957-218755979 AACTTCTAAAAGAAAACATTGGG + Intergenic
921775389 1:219093566-219093588 AACTATCAAAAGAAAACATTGGG + Intergenic
921941780 1:220848318-220848340 AACTACTCAAAGAAAATATTGGG - Intergenic
923340755 1:233005075-233005097 TGCTCTCAAAAGAAAACATTTGG + Intronic
923420865 1:233813616-233813638 AACTGTCACAAGACAACACTAGG + Intergenic
923846237 1:237735883-237735905 AACTGTGGATAGAAAATATTTGG - Intronic
924630370 1:245733337-245733359 AACTTCCACAAGAAAACATTGGG + Intergenic
924792336 1:247263502-247263524 AACTGCTATAAGAAAACATTGGG - Intergenic
924945180 1:248841618-248841640 AACTTTCAAAAGAATATATTTGG + Intronic
1063641422 10:7834299-7834321 AACTGCTAAAAGAAAACATAGGG - Intronic
1063983079 10:11471766-11471788 AACTGAACAATGAAAACACTTGG + Intronic
1065245981 10:23758154-23758176 AACTCTTCGAAGAAAACATGAGG - Intronic
1065634795 10:27720300-27720322 AACTGTGCAAGGAGACCATTAGG + Intronic
1065710891 10:28516656-28516678 AACTATTAAAAGAAAATATTGGG - Intergenic
1066016465 10:31249521-31249543 AACTCTTAGAAGAAAACATTGGG - Intergenic
1066021022 10:31302205-31302227 AACTACTCAAAGAAAACATAGGG - Intergenic
1066384076 10:34927268-34927290 AACTCTTAAAAGAAAACATAGGG + Intergenic
1066528907 10:36314842-36314864 AAGTGTCCAAAGAAAACACATGG - Intergenic
1066620945 10:37349202-37349224 ATTTCTACAAAGAAAACATTTGG - Intronic
1067262091 10:44702251-44702273 AACAGCCCAAAGAAGACAGTGGG - Intergenic
1067306397 10:45068686-45068708 AACTACTAAAAGAAAACATTGGG - Intergenic
1067673877 10:48352166-48352188 AATTCTCCAATGAAATCATTCGG - Intronic
1067707399 10:48619740-48619762 AACTACCAAAAGAAAACATCGGG + Intronic
1068139005 10:52980765-52980787 AACTTACCAAAGAAAACATCAGG - Intergenic
1068215744 10:53979721-53979743 AACTGTGAAAAGGAAACATGTGG + Intronic
1068382522 10:56275269-56275291 AACTGTCCCAAGTAAAAATGTGG + Intergenic
1068609003 10:59038045-59038067 AACTGAACAATGAGAACATTTGG - Intergenic
1068838880 10:61588078-61588100 ATATGTGAAAAGAAAACATTTGG + Intergenic
1069229460 10:65990861-65990883 AACTGCTTGAAGAAAACATTGGG - Intronic
1069479177 10:68765385-68765407 ATGTGTCCAAAGAAAGCATAAGG - Intronic
1070115816 10:73527874-73527896 CACTGTCCCAAAATAACATTTGG + Intronic
1070206382 10:74266963-74266985 AACCGTGGAAAGAAAATATTAGG + Intronic
1071209547 10:83323130-83323152 AACTGCTAAAAGAAAACATTGGG + Intergenic
1071799057 10:89037823-89037845 AACTACTAAAAGAAAACATTGGG - Intergenic
1071800847 10:89058050-89058072 AGTAGTTCAAAGAAAACATTGGG - Intergenic
1071899570 10:90105751-90105773 AACTGCTACAAGAAAACATTGGG + Intergenic
1072226415 10:93374062-93374084 AACTGAACAATGAGAACATTTGG - Intronic
1072347965 10:94527661-94527683 AACTATCAGAAGAAAACATAGGG - Intronic
1072843511 10:98802219-98802241 AACTACCAAGAGAAAACATTGGG + Intronic
1073625629 10:105093313-105093335 AACTTTTAAAAGAAAACATAGGG + Intronic
1073658145 10:105440366-105440388 AACTCTCAAAGGAAAACATAGGG - Intergenic
1074127114 10:110537443-110537465 AACTATTAGAAGAAAACATTGGG + Intergenic
1074215867 10:111383153-111383175 AATTATCCAAAGAAATAATTTGG + Intergenic
1074812314 10:117117934-117117956 AACTACCAAAAGAAAAAATTGGG + Intronic
1075749015 10:124749889-124749911 AACAAACAAAAGAAAACATTTGG - Intronic
1075853661 10:125609264-125609286 AATTGTCAAAACAAAACATAGGG - Intronic
1077695715 11:4390967-4390989 AACTATTATAAGAAAACATTGGG + Intronic
1077930576 11:6727888-6727910 AACTCCCAGAAGAAAACATTGGG - Intergenic
1079473338 11:20801677-20801699 AACTACTAAAAGAAAACATTGGG - Intronic
1079533093 11:21478570-21478592 AACTCCTAAAAGAAAACATTGGG + Intronic
1079565947 11:21882597-21882619 ATCTGTCCAATGCTAACATTGGG - Intergenic
1080067301 11:28032759-28032781 AACTGCTAAAAGAAAACATTGGG + Intronic
1080159549 11:29156764-29156786 AACTGTTAAAAAAAATCATTTGG - Intergenic
1080314693 11:30935850-30935872 AAATGTAAAAAGAAAACATGAGG - Intronic
1080865383 11:36189779-36189801 AACTGAACAATGAGAACATTTGG - Intronic
1080941992 11:36929108-36929130 AAATGTCCAGAGAGAAAATTTGG + Intergenic
1080998023 11:37628680-37628702 AACTACTCAAAGAAAACATAGGG - Intergenic
1081143903 11:39537061-39537083 AACTGCTACAAGAAAACATTAGG - Intergenic
1081153672 11:39663535-39663557 AACATTCCAAAGAAACAATTAGG - Intergenic
1081169924 11:39854779-39854801 ATCTGTCCAAAGAACATTTTGGG + Intergenic
1081212217 11:40350190-40350212 AACTACTAAAAGAAAACATTGGG - Intronic
1081555344 11:44155198-44155220 AACTATTCAAAGAAAACACTAGG - Intronic
1082188371 11:49211265-49211287 AACTTTCTCAAGAAAACAATGGG + Intergenic
1082615200 11:55350701-55350723 AACTGTTAGAAGAAAACAGTGGG - Intergenic
1083505601 11:63154641-63154663 AACTGCTGAAATAAAACATTGGG - Intronic
1083917056 11:65753870-65753892 AACTACCAAAAGAAAACACTGGG - Intergenic
1083991195 11:66246751-66246773 AACTGTGGAAAGGAAACTTTTGG - Intergenic
1084281947 11:68102593-68102615 AACTGCCATAAGAAAACATAGGG + Intronic
1085007651 11:73108503-73108525 AACTGCTAAAAGAAAACATTAGG - Intronic
1085178970 11:74517006-74517028 AACTATTAAAAGAAAATATTGGG + Intronic
1085365049 11:75933399-75933421 AACTATTAAAAGAAAATATTGGG + Intronic
1085617592 11:78013182-78013204 AACTTTCCAAATAAAAAGTTTGG + Intergenic
1086114371 11:83231651-83231673 AACTACTAAAAGAAAACATTGGG - Intronic
1086184347 11:83995866-83995888 AACTACTCTAAGAAAACATTGGG + Intronic
1086678151 11:89635376-89635398 AACTTTCTCAAGAAAACAATTGG - Intergenic
1086737497 11:90324117-90324139 AACTGCTATAAGAAAACATTGGG - Intergenic
1087031442 11:93709245-93709267 AACTACTAAAAGAAAACATTGGG - Intronic
1087089888 11:94258366-94258388 AACTACCATAAGAAAACATTTGG - Intergenic
1087133460 11:94690790-94690812 AACTACCAAAAGAAAACATCGGG + Intergenic
1087184393 11:95172347-95172369 AAATGTGCAAAGAAAATTTTTGG + Exonic
1087418328 11:97887341-97887363 AACTGCCCAAAGAAATAATCTGG - Intergenic
1087637793 11:100722232-100722254 AACTCACCAAAGAATACATAAGG - Intronic
1087667550 11:101068743-101068765 ACCTGACCAAAAAAAACAATGGG + Intronic
1087794865 11:102444959-102444981 AACTGAACAAAGAGAACACTTGG + Intronic
1087910866 11:103752030-103752052 AACTGTCTGAAGAAAACAGTGGG - Intergenic
1087963255 11:104378271-104378293 AAATGTACAAAGGAAACTTTAGG - Intergenic
1088825659 11:113491692-113491714 AAATGTCTAAAGAAAATACTAGG - Intergenic
1089079937 11:115767176-115767198 AACTGTTCAAGGCAAGCATTAGG + Intergenic
1089336650 11:117729313-117729335 AACTGTTAGAAGAAAACATAGGG + Intronic
1090008736 11:123026516-123026538 AACAGTACAAAGATAAAATTGGG - Intergenic
1090023538 11:123148589-123148611 TACTGTCCAAGGAAAATCTTGGG - Intronic
1090145453 11:124316705-124316727 AACTACTAAAAGAAAACATTGGG - Intergenic
1090321906 11:125852625-125852647 AACTGCTACAAGAAAACATTGGG - Intergenic
1090902598 11:131046075-131046097 AAGTGTCCAAAGAGAACAAGAGG + Intergenic
1091598761 12:1903257-1903279 AACTACTAAAAGAAAACATTGGG + Intronic
1092324854 12:7519724-7519746 AACTGCCATAAGAAAACATTAGG - Intergenic
1092847452 12:12596922-12596944 AACTGAACAATGAAAACACTTGG + Intergenic
1093326793 12:17785091-17785113 AACTGAACAATGAAAACACTTGG + Intergenic
1093342979 12:18001355-18001377 AATTGTCCCAAGAGAAAATTAGG + Intergenic
1093419574 12:18959277-18959299 AACTACTAAAAGAAAACATTGGG - Intergenic
1093574738 12:20713377-20713399 TGCTGTCAAAAGAAAACATCTGG - Intronic
1093673492 12:21905211-21905233 AACTGAACAATGAAAACACTTGG + Intronic
1093819589 12:23597379-23597401 AAATGTCCAAATAGATCATTAGG - Intronic
1093887593 12:24480301-24480323 AACTACTAAAAGAAAACATTGGG + Intergenic
1093985814 12:25531414-25531436 AAATATCCAATGAAAACATTGGG - Intronic
1094158650 12:27365717-27365739 AAATGTACAAAAAAAAAATTTGG - Intronic
1094420552 12:30266310-30266332 AACTACTAAAAGAAAACATTGGG + Intergenic
1094440955 12:30476348-30476370 AACTGCTACAAGAAAACATTGGG + Intergenic
1094559763 12:31541100-31541122 AACTACTAAAAGAAAACATTGGG + Intronic
1094795814 12:33971384-33971406 AACTCACCAAAGAAGACATAAGG + Intergenic
1095108562 12:38265256-38265278 AACTCACCAAAGAAGACATAAGG + Intergenic
1095408322 12:41892720-41892742 AACTGTACACAGAAAACAAAGGG - Intergenic
1095788661 12:46139589-46139611 AACTACCAAAAGAAGACATTGGG - Intergenic
1095977355 12:47948953-47948975 AACTGTCCAAACAAGACAGCTGG - Intergenic
1096865698 12:54561438-54561460 AACTGACCAGAGAGAACTTTGGG - Intronic
1097947181 12:65382973-65382995 AATTTTGCAAAGAAAACTTTTGG - Intronic
1098332915 12:69373723-69373745 AACTACTAAAAGAAAACATTGGG - Intronic
1098362604 12:69669318-69669340 AATTGTTCAAAGAAACAATTAGG - Intronic
1098385398 12:69913401-69913423 AACTCTTCAAAGAAAACAAAGGG - Intronic
1098396401 12:70022640-70022662 AACTACTAAAAGAAAACATTGGG + Intergenic
1098409129 12:70160867-70160889 AACTACTAAAAGAAAACATTGGG + Intergenic
1099026377 12:77469364-77469386 AAGAACCCAAAGAAAACATTTGG - Intergenic
1099026960 12:77476638-77476660 AACAATTAAAAGAAAACATTTGG - Intergenic
1099048841 12:77758516-77758538 AACTTTCCAAAGACAAACTTGGG - Intergenic
1099425999 12:82523176-82523198 AAATTTACAAAGAAAATATTTGG - Intergenic
1099491601 12:83294548-83294570 AACTATTAAAAGAAAACACTGGG + Intergenic
1100876070 12:98963556-98963578 AACTATTAAAAGCAAACATTGGG + Intronic
1100938880 12:99702871-99702893 AACTACTAAAAGAAAACATTGGG - Intronic
1101025733 12:100603728-100603750 AACTGCTACAAGAAAACATTGGG - Intronic
1101286996 12:103325051-103325073 AATTATCCAAACAAAACAGTTGG + Intronic
1101287874 12:103334724-103334746 AACTGCCCAAAGAAATCGCTCGG + Intronic
1101623358 12:106413227-106413249 AACTTTTAGAAGAAAACATTGGG - Intronic
1102330697 12:112027054-112027076 GACTCTCCAAAGCAAACATTTGG - Exonic
1103115499 12:118326109-118326131 AACTACTAAAAGAAAACATTGGG - Intronic
1103315282 12:120049474-120049496 ACCTTTCCAGAGAAAACACTTGG - Intronic
1104533673 12:129597153-129597175 AACTGTGGATAGAAAATATTTGG - Intronic
1105775019 13:23651482-23651504 AACTCTCTAATGAAAACATAAGG + Intronic
1106000825 13:25721453-25721475 AACTGCTGGAAGAAAACATTGGG - Intronic
1106223742 13:27769733-27769755 AACTGTCCAAAGGAAACAACAGG - Intergenic
1106772588 13:32976142-32976164 CACTGTGGAAAAAAAACATTAGG + Intergenic
1106848991 13:33768038-33768060 AACTGGCAAAAGCAAAGATTAGG + Intergenic
1106909289 13:34446097-34446119 GAGTGTGCAAAGATAACATTGGG - Intergenic
1107081758 13:36382422-36382444 AACAGTTAAAAGATAACATTTGG - Intergenic
1107918686 13:45180742-45180764 ACCCTTCTAAAGAAAACATTAGG - Intronic
1107974747 13:45678602-45678624 CACTTATCAAAGAAAACATTGGG - Intergenic
1108231999 13:48354959-48354981 AACTGCTATAAGAAAACATTGGG + Intronic
1108439374 13:50434877-50434899 ACCTTTCCAAAGAAAACTTCTGG - Intronic
1108641667 13:52388298-52388320 AAATGTTCAAAGAAATCCTTTGG + Intronic
1108655468 13:52527829-52527851 AACTATAACAAGAAAACATTGGG + Intergenic
1108973788 13:56410706-56410728 AACTTCTAAAAGAAAACATTGGG + Intergenic
1109103243 13:58213526-58213548 AACTATCAAAACAAAGCATTAGG + Intergenic
1109361197 13:61297393-61297415 AACTTTTCATAGAAACCATTTGG - Intergenic
1109383694 13:61599648-61599670 AACTGTTCAAAGTAGACTTTTGG + Intergenic
1109413437 13:62004688-62004710 TACTGTCTAAAGAAAGCAATAGG + Intergenic
1109776980 13:67053521-67053543 AAATATACAAAGAAGACATTAGG + Intronic
1109942003 13:69380615-69380637 AACTACTAAAAGAAAACATTGGG - Intergenic
1110002579 13:70223558-70223580 AAGTGTTCATAGAAAACACTAGG - Intergenic
1110350002 13:74495878-74495900 AACTGAACAATGAAAACACTTGG + Intergenic
1110381057 13:74851386-74851408 AACTGTGAAAAGTAAACAGTAGG - Intergenic
1110491648 13:76117037-76117059 AACTATTTGAAGAAAACATTGGG + Intergenic
1110515756 13:76410865-76410887 AACTGTCCAAAGAGATAGTTGGG - Intergenic
1110764752 13:79269997-79270019 AAGTATCAAAAGAAAACATCTGG + Intergenic
1110828951 13:80007908-80007930 ACCTGCCAAAAGAAAACAGTTGG - Intergenic
1111356123 13:87104920-87104942 AACTATTAGAAGAAAACATTGGG + Intergenic
1111577091 13:90169406-90169428 AACTGCTAAAAGAAAACATAGGG + Intergenic
1112081665 13:95978624-95978646 AACTGCTAGAAGAAAACATTGGG - Intronic
1112706069 13:102069923-102069945 AACTACTAAAAGAAAACATTGGG + Intronic
1112846889 13:103654705-103654727 TTCTGTCCAACGTAAACATTAGG - Intergenic
1113538558 13:111087503-111087525 AACTTTTCAGAGAAAACTTTGGG - Intergenic
1114287033 14:21254453-21254475 AGCTATCCAAAGATAACATTTGG - Intronic
1114813755 14:25930799-25930821 AACTGGCAAAAGAAAGCATTAGG - Intergenic
1114877964 14:26746713-26746735 AACTACTTAAAGAAAACATTGGG + Intergenic
1115297271 14:31842937-31842959 AGGTGTAAAAAGAAAACATTAGG - Intronic
1116128285 14:40818220-40818242 AACTGAACAATGAAAACACTTGG - Intergenic
1116210414 14:41933635-41933657 AACTACCAGAAGAAAACATTGGG + Intergenic
1116668459 14:47809729-47809751 AACTATTAAAAGAAAACATCGGG - Intergenic
1116903245 14:50381340-50381362 CACTGTCCTAAGAAAACATCTGG + Intronic
1117059243 14:51944693-51944715 AACTCTTAAAAGAAAACATAGGG + Intronic
1117437118 14:55726824-55726846 AACTGAACAATGAAAACACTTGG - Intergenic
1118240930 14:64058220-64058242 AACTACTAAAAGAAAACATTGGG - Intronic
1118383144 14:65234364-65234386 AACTACTAAAAGAAAACATTGGG - Intergenic
1118509566 14:66456646-66456668 AACTACTAAAAGAAAACATTGGG + Intergenic
1119311965 14:73654916-73654938 AACTGTACAAGGAAAAATTTTGG + Intronic
1120473237 14:84953612-84953634 AAGTGACCAATGAAAACACTGGG - Intergenic
1202841992 14_GL000009v2_random:130180-130202 AACTACTGAAAGAAAACATTAGG + Intergenic
1202911382 14_GL000194v1_random:120414-120436 AACTACTGAAAGAAAACATTAGG + Intergenic
1202881236 14_KI270722v1_random:62219-62241 AACTACTGAAAGAAAACATTAGG - Intergenic
1123462596 15:20487083-20487105 AAGTGCTAAAAGAAAACATTGGG - Intergenic
1123655465 15:22513319-22513341 AAGTGCTAAAAGAAAACATTGGG + Intergenic
1124273283 15:28303103-28303125 AAGTGCTAAAAGAAAACATTGGG - Intronic
1124309372 15:28608514-28608536 AAGTGCTAAAAGAAAACATTGGG + Intergenic
1124498708 15:30207498-30207520 AACTGTCTACTAAAAACATTAGG + Intergenic
1124554733 15:30714051-30714073 AACTACCAGAAGAAAACATTGGG - Intronic
1124593476 15:31074324-31074346 AACTGTCCAAAGAAAAGCCCAGG - Intronic
1124744871 15:32331178-32331200 AACTGTCTACTAAAAACATTAGG - Intergenic
1125191830 15:37002386-37002408 AAGTGTCAAAAGAAAACTATGGG - Intronic
1125276540 15:37998298-37998320 AACTACTAAAAGAAAACATTAGG - Intergenic
1125351432 15:38771311-38771333 AACTGTATAAAGAATTCATTAGG + Intergenic
1126277063 15:46895820-46895842 CACTGTCAAAATAAAACTTTAGG + Intergenic
1127403706 15:58618408-58618430 AACTACTAAAAGAAAACATTGGG + Intronic
1127476856 15:59342437-59342459 AACTACTAAAAGAAAACATTGGG - Intronic
1127693868 15:61424817-61424839 AACTGGCCAATGAAAACATAAGG - Intergenic
1127740924 15:61904025-61904047 AACTATTTAAAGAAAACATTGGG + Intronic
1127765391 15:62181173-62181195 AACCATCAAAAGAAAACATTGGG + Intergenic
1127778379 15:62288239-62288261 AAATGATCAAAGAAAAGATTTGG - Intergenic
1127814411 15:62594699-62594721 AACTGTTAAAAGAAAACATAAGG + Intronic
1127889599 15:63237832-63237854 AACTACTAAAAGAAAACATTGGG - Intronic
1128399422 15:67262548-67262570 AAGCATCCAAAGAAAGCATTTGG - Intronic
1129408358 15:75334836-75334858 AACTGTGCATCGAAAATATTTGG + Intergenic
1130200751 15:81824481-81824503 AACTGAACAAAGAGAACACTTGG + Intergenic
1130962431 15:88671074-88671096 AACTACTAAAAGAAAACATTGGG + Intergenic
1131500821 15:92964147-92964169 AACTGGCCAAAGGAAAATTTTGG - Intronic
1131630521 15:94172059-94172081 AACTCCGCAAAGAAAACATAGGG + Intergenic
1135897847 16:26425174-26425196 AACTGAACAATGAAAACACTTGG + Intergenic
1138490056 16:57371571-57371593 ATCTGCCCAAAGAGAGCATTGGG - Intergenic
1140449474 16:75058887-75058909 AACAGTCCAAGGAAAACACAAGG - Intronic
1140539836 16:75746848-75746870 AAATGTCCACAGAAACCCTTGGG + Intronic
1142332674 16:89464955-89464977 GACTGTCTAAAAAAGACATTGGG - Intronic
1142902720 17:3022835-3022857 AACTCCTAAAAGAAAACATTGGG - Intronic
1143342370 17:6223006-6223028 AACTGAACAATGAGAACATTTGG - Intergenic
1143383859 17:6514155-6514177 AACTTTACAAAGAAAACATGGGG + Intronic
1143420280 17:6785386-6785408 AACTGCTACAAGAAAACATTGGG + Intronic
1144197689 17:12911155-12911177 AACTGTTCAAAGAAAATTTCAGG + Intronic
1144700821 17:17338002-17338024 AACTACTAAAAGAAAACATTGGG - Intronic
1145756356 17:27393763-27393785 AACTACTAAAAGAAAACATTGGG - Intergenic
1146092091 17:29889469-29889491 AACTCTCAGAAGAAAACATAGGG + Intronic
1146149915 17:30458557-30458579 AACTCTTCAAAGAAAACACAAGG - Intronic
1146600418 17:34209948-34209970 AACTGTACAATGAAAACACTTGG - Intergenic
1148915856 17:50977951-50977973 ATCTGTGCAAAGAAAACTTAAGG - Intronic
1149693586 17:58598777-58598799 AAGTCTCCAAAGTAAACACTGGG - Intronic
1150031189 17:61737429-61737451 AACTCTTCAAGGAAAACATTAGG + Intronic
1150201694 17:63363458-63363480 AACTATTAAAAGAAAATATTAGG - Intronic
1150547740 17:66178655-66178677 AACTGCTAAAAGAAAACATTGGG - Intronic
1151132685 17:71914445-71914467 ATCTGTCCAAAGAAATAATTAGG - Intergenic
1152451812 17:80386409-80386431 AACTCTCCAAGGAAAACAACAGG + Exonic
1152909904 17:82996938-82996960 AACTACTGAAAGAAAACATTGGG + Intronic
1153074882 18:1150666-1150688 AACTACCACAAGAAAACATTGGG - Intergenic
1153402894 18:4700591-4700613 AACTGAACAATGAGAACATTTGG + Intergenic
1153491321 18:5651401-5651423 AACTCTCAGAAGAAAACATAGGG - Intergenic
1154017731 18:10635070-10635092 AACTCTCAGAAGAAAATATTGGG + Intergenic
1154038441 18:10830571-10830593 AACTACTAAAAGAAAACATTGGG + Intronic
1154187134 18:12194521-12194543 AACTCTCAGAAGAAAATATTGGG - Intergenic
1155197786 18:23491140-23491162 AACTACCACAAGAAAACATTGGG + Intergenic
1155414106 18:25578734-25578756 AACTGAACAATGAGAACATTTGG + Intergenic
1155556662 18:27027474-27027496 ATCTTTCAAAAGAAAATATTGGG - Intronic
1155603840 18:27581050-27581072 AATTGTGCAAACAGAACATTTGG - Intergenic
1155882496 18:31166997-31167019 GACTGCCCAAAGATAACACTAGG + Intergenic
1155933832 18:31734409-31734431 AACTACTCAAAGAAAACATAAGG + Intergenic
1156911964 18:42421800-42421822 AACTCTTAAAAGAAAACATTGGG - Intergenic
1156933693 18:42676723-42676745 AACTGTCCAGTGAATAAATTGGG + Intergenic
1157401424 18:47391698-47391720 TGCTATCAAAAGAAAACATTAGG - Intergenic
1157714055 18:49870334-49870356 AACTCTCAGAAGAAAACATAGGG + Intronic
1157865112 18:51176249-51176271 AACAGTCATAAGAAATCATTAGG + Exonic
1158224479 18:55186408-55186430 AACTCTCTCATGAAAACATTTGG - Intergenic
1158250173 18:55479258-55479280 AGCAGTCCAATGAAGACATTGGG - Intronic
1159102681 18:63972690-63972712 AACTGAACAATGAAAACACTTGG - Intronic
1159221391 18:65468625-65468647 AACAGTCTAAAGAAAAGTTTGGG - Intergenic
1159294816 18:66471220-66471242 AACTCTTCAAAGAAATCCTTGGG + Intergenic
1159802178 18:72914774-72914796 AACTACTGAAAGAAAACATTGGG - Intergenic
1160588080 18:79923632-79923654 AACTCTCAGAAGAAAACATGAGG + Intronic
1161904332 19:7144103-7144125 AATTGTCCAAAGGAAGCAGTGGG - Intronic
1162559973 19:11411443-11411465 AACTGTCAAAAGAAAATTTAGGG + Intronic
1162980026 19:14232790-14232812 AACTGTGAATGGAAAACATTAGG + Intergenic
1163533358 19:17863321-17863343 CAGTGTGCAAAGAAAACATGCGG - Intronic
1164547313 19:29179038-29179060 AACTACTAAAAGAAAACATTGGG + Intergenic
1164660340 19:29959483-29959505 AAATGTCCAAGAAAAATATTGGG - Intronic
1164688128 19:30184858-30184880 AACTGAACAATGAGAACATTTGG - Intergenic
1165085049 19:33339218-33339240 AACTTCCCAAATAAATCATTTGG - Intergenic
1165235514 19:34417820-34417842 AACTATTCAAAGATAAAATTGGG + Intronic
1166407754 19:42533539-42533561 AACTCTCAGAAGAAAACATAAGG + Intronic
1202656844 1_KI270708v1_random:31325-31347 AACTACTGAAAGAAAACATTAGG - Intergenic
925588750 2:5489128-5489150 AACTACTGAAAGAAAACATTGGG + Intergenic
925692085 2:6535734-6535756 AAGTGTCCACACAAAACAATGGG - Intergenic
925700643 2:6633968-6633990 AACTGTCCATAATAAAAATTAGG + Intergenic
926065271 2:9834145-9834167 AACTACTAAAAGAAAACATTGGG + Intergenic
926453710 2:13039132-13039154 AACTCTCAGAAGAAAACATTGGG - Intergenic
926602251 2:14857714-14857736 AACTACTGAAAGAAAACATTGGG + Intergenic
927221989 2:20721016-20721038 AACTACTAAAAGAAAACATTAGG + Intronic
927625840 2:24717807-24717829 AACTGTCCAATCTAAACACTGGG + Intronic
928110618 2:28505948-28505970 CAGTGTCCAAAGCAGACATTTGG - Intronic
928703594 2:33923762-33923784 AACTCTCATAAGAAAACATAAGG - Intergenic
929843694 2:45499594-45499616 AACTGCTAAAAGAAAACATTGGG - Intronic
930003228 2:46875570-46875592 CACTGTCAAAAGACAAAATTAGG + Intergenic
930189766 2:48445559-48445581 AGCTGTCCAAAGACCACACTTGG + Intronic
930624490 2:53681470-53681492 AACTACTAAAAGAAAACATTGGG - Intronic
930728188 2:54702497-54702519 AACTACCAAAATAAAACATTAGG + Intergenic
931055029 2:58460224-58460246 AATTGTAGAAAGAAAACAGTGGG + Intergenic
931085513 2:58825738-58825760 AATTATTAAAAGAAAACATTGGG - Intergenic
931375937 2:61708428-61708450 AAGTTTCCAAAGGAAATATTAGG + Intergenic
932110221 2:68992519-68992541 AACCTGTCAAAGAAAACATTTGG - Intergenic
932241324 2:70159223-70159245 AACAGTTCCAAGAAAATATTAGG + Intronic
932724899 2:74170977-74170999 AATTTTAAAAAGAAAACATTTGG + Intronic
933114776 2:78454621-78454643 AACTGTCCACAGAAGAAATGTGG - Intergenic
933594414 2:84268284-84268306 AACTGAACAATGAGAACATTTGG + Intergenic
933855501 2:86410047-86410069 AACTCTCAGAAGAAAACATAGGG + Intergenic
935083603 2:99823315-99823337 AACTGACCAAAAATACCATTAGG + Intronic
935533016 2:104258703-104258725 AACTGCTACAAGAAAACATTGGG + Intergenic
936282064 2:111150637-111150659 AAATGTCCAAAGACAGCAATGGG - Intronic
936388347 2:112050615-112050637 AATTGTCCAAAGAACAAATAAGG - Intergenic
936976771 2:118228680-118228702 AAATGTCCACAAAAAATATTGGG - Intergenic
937192875 2:120121401-120121423 AACTGAACAATGAAAACACTTGG - Intronic
937613053 2:123886595-123886617 AACTACTAAAAGAAAACATTGGG - Intergenic
938012428 2:127839605-127839627 AACTGTTTTAAGGAAACATTGGG - Intergenic
938222636 2:129583965-129583987 AAGTTTCCAAAGAAAGCACTAGG + Intergenic
939143420 2:138382399-138382421 AAGTATTCAAAGAAAACATAGGG + Intergenic
939206002 2:139104436-139104458 AACTCCTCAAAGAAAATATTAGG - Intergenic
939336183 2:140831564-140831586 AACTACTGAAAGAAAACATTTGG + Intronic
939352156 2:141053067-141053089 AAATGACCAAAGAAAATAATGGG - Intronic
939435527 2:142172344-142172366 AACAGGCAAAAGAAACCATTTGG - Intergenic
939542876 2:143514920-143514942 ATCATTCCAAAGAAGACATTTGG + Intronic
939948948 2:148445337-148445359 AACTGAACAATGAGAACATTTGG - Intronic
940179981 2:150921362-150921384 CACTGCCAAAAGAGAACATTGGG - Intergenic
940339028 2:152559976-152559998 AACTGCCAAAATAAAATATTTGG - Intronic
940365245 2:152841133-152841155 AACTCCTAAAAGAAAACATTGGG - Intergenic
940795829 2:158077680-158077702 AACTGCTACAAGAAAACATTGGG + Intronic
940891149 2:159036560-159036582 AATTGAACAATGAAAACATTTGG - Intronic
941417421 2:165238719-165238741 AATTGTCAAAAGAATCCATTTGG - Intergenic
941541564 2:166792306-166792328 AGCTGACCAAAGACAACAATGGG + Intergenic
942257999 2:174126185-174126207 AACAGATGAAAGAAAACATTTGG + Intronic
942733590 2:179084907-179084929 AACTAACACAAGAAAACATTGGG - Intergenic
942907776 2:181204593-181204615 AACTATGGAAAGAAAACATATGG + Intergenic
943121232 2:183738733-183738755 AACAGACCAAAGAAAATTTTAGG + Intergenic
943277236 2:185882889-185882911 AATTGAACAAAGAGAACATTTGG - Intergenic
944192755 2:197020998-197021020 AACTGAACAATGAAAACACTTGG - Intronic
944201006 2:197107396-197107418 AACTGACCAAAGACAGCATCTGG - Intronic
944519552 2:200550728-200550750 AACTATTAGAAGAAAACATTGGG + Intronic
945211168 2:207383943-207383965 AACTACTAAAAGAAAACATTGGG + Intergenic
945576110 2:211531207-211531229 AACTATTAAAATAAAACATTGGG + Intronic
945754060 2:213824340-213824362 AACTGCTAAAAGAAAACATTGGG - Intronic
946012276 2:216575030-216575052 ATCTGTCAAAAGAAGAGATTAGG - Intronic
946058989 2:216925679-216925701 AGCTGTCAGAAGAAAACATAAGG - Intergenic
946695618 2:222355587-222355609 AACTGCCATAAAAAAACATTTGG - Intergenic
946800159 2:223406128-223406150 AACTGAACAATGAGAACATTTGG + Intergenic
947358964 2:229327260-229327282 AACTCTACAAAGAAAACTTAAGG + Intergenic
948775100 2:240283076-240283098 AACTACTAAAAGAAAACATTAGG + Intergenic
1169622157 20:7519562-7519584 AACTCTTCAAAGAAAACATAAGG - Intergenic
1169675465 20:8148350-8148372 AAATGTCAAAAAAAGACATTTGG - Intronic
1169991581 20:11509901-11509923 AACTACTCAATGAAAACATTGGG + Intergenic
1170063143 20:12281636-12281658 AACTACTAAAAGAAAACATTGGG + Intergenic
1170091157 20:12590938-12590960 AACTCAGCAAAGAAAACTTTTGG - Intergenic
1170608472 20:17892261-17892283 CACTATTAAAAGAAAACATTGGG + Intergenic
1171000557 20:21411060-21411082 AACTGCTAAAAGAAAACATAGGG - Intergenic
1171818463 20:29810262-29810284 AACTTTTACAAGAAAACATTGGG - Intergenic
1172268243 20:33636005-33636027 AAATTTCAAAATAAAACATTAGG - Intronic
1172451789 20:35030701-35030723 AACTGTACAAAGAAAACGGGTGG - Intronic
1172498434 20:35407057-35407079 AACTTTCAAAAGAAAACTTACGG + Intronic
1173299849 20:41792624-41792646 ATTTGTCCAAAGAAAATATGAGG + Intergenic
1173303473 20:41825816-41825838 AACTATTAAAAGAAAACACTGGG - Intergenic
1173409083 20:42793798-42793820 ACCTGTCCAAGGAAACCTTTTGG - Intronic
1174713844 20:52735634-52735656 AACTGTCCAAAGAAGCCTTCTGG - Intergenic
1174939404 20:54908114-54908136 AACTACTTAAAGAAAACATTGGG + Intergenic
1174981740 20:55403132-55403154 AACTTCTAAAAGAAAACATTTGG - Intergenic
1175035148 20:55993233-55993255 AACTGAACAATGAGAACATTTGG - Intergenic
1175237001 20:57521285-57521307 AAGTGACCAATGAAAACATGAGG + Intronic
1175747614 20:61469658-61469680 AATTATTAAAAGAAAACATTGGG - Intronic
1176345523 21:5741838-5741860 AACTTCTGAAAGAAAACATTGGG - Intergenic
1176347787 21:5766748-5766770 AATTGACCAAAGAGAACATATGG - Intergenic
1176352337 21:5862422-5862444 AACTTCTGAAAGAAAACATTGGG - Intergenic
1176354601 21:5887332-5887354 AATTGACCAAAGAGAACATATGG - Intergenic
1176497040 21:7557707-7557729 AATTGACCAAAGAGAACATATGG + Intergenic
1176499304 21:7582617-7582639 AACTTCTGAAAGAAAACATTGGG + Intergenic
1176539844 21:8139908-8139930 AACTTCTGAAAGAAAACATTGGG - Intergenic
1176542108 21:8164818-8164840 AATTGACCAAAGAGAACATATGG - Intergenic
1176558795 21:8322953-8322975 AACTTCTGAAAGAAAACATTGGG - Intergenic
1176561059 21:8347863-8347885 AATTGACCAAAGAGAACATATGG - Intergenic
1176630739 21:9135083-9135105 AACTACTGAAAGAAAACATTAGG + Intergenic
1176642543 21:9319745-9319767 AACTACTGAAAGAAAACATTAGG - Intergenic
1176894821 21:14364148-14364170 AATGTTCCAAAGAAAATATTAGG - Intergenic
1176928969 21:14784854-14784876 AACTGAGCAATGAAAACACTTGG + Intergenic
1176939380 21:14905474-14905496 AACTACTAAAAGAAAACATTTGG - Intergenic
1177108118 21:16986746-16986768 AACTGCCACAAGAAAACATCGGG - Intergenic
1177131570 21:17262870-17262892 AACTTTAAAAAGACAACATTTGG + Intergenic
1177251451 21:18596991-18597013 AACTGAACAAAGAGAACACTTGG + Intergenic
1177485568 21:21750927-21750949 AAATTTCAAAAGAAAACAATAGG + Intergenic
1177535617 21:22423082-22423104 AGATGTCCAAAGAAAGAATTGGG + Intergenic
1177548322 21:22588603-22588625 AAATGTCCAAATAAAAAAGTTGG - Intergenic
1177630724 21:23724163-23724185 AACTGTCTAAAGATATAATTAGG - Intergenic
1177771788 21:25524953-25524975 AACTACTAAAAGAAAACATTGGG + Intergenic
1178211864 21:30543845-30543867 AACTGCTATAAGAAAACATTGGG - Intronic
1178778175 21:35572652-35572674 AACACTCCAGAGAAGACATTAGG + Intronic
1180333155 22:11551017-11551039 AACTTTTACAAGAAAACATTGGG + Intergenic
1180375854 22:12092543-12092565 AACTAGTGAAAGAAAACATTAGG - Intergenic
1181374436 22:22444941-22444963 AAATCTTAAAAGAAAACATTAGG + Intergenic
1182201473 22:28575126-28575148 AACTACTAAAAGAAAACATTGGG - Intronic
1182704361 22:32267066-32267088 AACTGTTCAAACAAAACATTTGG - Intergenic
1203244795 22_KI270733v1_random:56263-56285 AACTTCTGAAAGAAAACATTGGG - Intergenic
1203247050 22_KI270733v1_random:81235-81257 AATTGACCAAAGAGAACATATGG - Intergenic
949149088 3:742699-742721 AACCGTGAATAGAAAACATTCGG + Intergenic
949622679 3:5832444-5832466 AACTACTCAAAGAAAACACTGGG - Intergenic
951379031 3:21959935-21959957 AACTGCTAAAAGAAAACATAGGG + Intronic
951434716 3:22648479-22648501 AACTACCACAAGAAAACATTGGG - Intergenic
951511721 3:23509778-23509800 AACTGAACAATGAGAACATTTGG - Intronic
952120561 3:30238444-30238466 AACTACTAAAAGAAAACATTGGG - Intergenic
952602119 3:35096476-35096498 AACTACTAAAAGAAAACATTGGG - Intergenic
952602132 3:35096642-35096664 AACTGCCAAAAGCATACATTGGG - Intergenic
952602142 3:35096746-35096768 AACTGCCAAAAGCATACATTGGG - Intergenic
952811144 3:37404363-37404385 AAGTGTAGAAAGGAAACATTGGG - Intronic
953343635 3:42156810-42156832 AAATGATCAAAGTAAACATTGGG + Intronic
955119282 3:56040035-56040057 AACTGCCCAAAGAAAACATAAGG + Intronic
955605233 3:60694854-60694876 AACTGAACAATGAAAACACTTGG + Intronic
956223259 3:66926685-66926707 AACTGCTACAAGAAAACATTGGG + Intergenic
957097559 3:75790907-75790929 AACTGCTGAAAGAAAACATTAGG + Intergenic
958010981 3:87879896-87879918 AAATGTACAAACAGAACATTAGG + Intergenic
958686229 3:97400039-97400061 AACTATTTAAAGAAAACACTAGG - Intronic
958878959 3:99647732-99647754 AAATGCTCAAAGAAAATATTTGG - Intronic
958942051 3:100327693-100327715 AACTGAACAATTAAAACATTTGG + Intergenic
958948537 3:100392365-100392387 AATACACCAAAGAAAACATTGGG + Intronic
959195761 3:103179612-103179634 AACTGCTAATAGAAAACATTGGG + Intergenic
959259407 3:104056047-104056069 AACTACTGAAAGAAAACATTGGG + Intergenic
959443677 3:106411140-106411162 AACTGCTAAAAGAAAACATTGGG - Intergenic
959779607 3:110213575-110213597 AACTACTAAAAGAAAACATTAGG + Intergenic
959842107 3:110989332-110989354 AACTACTAAAAGAAAACATTGGG + Intergenic
960067595 3:113391384-113391406 AACAATTAAAAGAAAACATTGGG + Intronic
960151858 3:114257488-114257510 AACTACTAAAAGAAAACATTGGG - Intergenic
960229740 3:115211273-115211295 AACTGTCCACAGGAAAAATCAGG - Intergenic
960385425 3:117016768-117016790 AAGGGTCCAAAGAGAATATTTGG - Intronic
960471323 3:118069286-118069308 AACTGCTACAAGAAAACATTGGG - Intergenic
960566446 3:119137606-119137628 AACTACCAAAAGAAAACTTTGGG + Intronic
960744133 3:120867729-120867751 AACTGAACAATGAAAACACTTGG + Intergenic
960930994 3:122849924-122849946 AACTACTAAAAGAAAACATTGGG - Intronic
961246488 3:125458514-125458536 CACTGTAAAAAGAAAAGATTCGG + Intronic
962194002 3:133341925-133341947 AACTACTAAAAGAAAACATTGGG + Intronic
962305849 3:134285258-134285280 AACTACTGAAAGAAAACATTGGG + Intergenic
962346357 3:134621608-134621630 AACTCTCAGAAGAAAACACTGGG + Intronic
962734435 3:138312647-138312669 AACTATCAAAAGACAACATTGGG + Intronic
963205696 3:142631760-142631782 AACTCTTAGAAGAAAACATTGGG + Intronic
963365500 3:144329267-144329289 AACTGTTATAAGAAAACATTGGG + Intergenic
963428067 3:145157605-145157627 AACTGAACAATGAGAACATTTGG + Intergenic
963515643 3:146305377-146305399 AACTGCTGCAAGAAAACATTGGG + Intergenic
964021343 3:152016028-152016050 TACTGTACAAATAAATCATTTGG - Intergenic
964140305 3:153391012-153391034 AACTACTAAAAGAAAACATTGGG - Intergenic
964254119 3:154755529-154755551 AACTGCTAAAAGAAAGCATTGGG + Intergenic
964337595 3:155672844-155672866 ATCTTTCATAAGAAAACATTAGG - Intronic
964462186 3:156945549-156945571 AACTACTAAAAGAAAACATTAGG - Intronic
964560555 3:157990880-157990902 AACTCTGCAAAGAATACTTTAGG - Intergenic
964567740 3:158076015-158076037 ACCTGTCCCAAAAAATCATTTGG + Intergenic
964652479 3:159026985-159027007 AACTACTAAAAGAAAACATTGGG + Intronic
964896588 3:161603683-161603705 AACTGAACAATGAAAACACTTGG - Intergenic
964927988 3:161979903-161979925 AACTACTGAAAGAAAACATTGGG - Intergenic
964961434 3:162432705-162432727 AATAGTGAAAAGAAAACATTGGG + Intergenic
964962536 3:162445682-162445704 AACTGAACAATGAAAACACTTGG - Intergenic
965046324 3:163583095-163583117 AACTACTAAAAGAAAACATTGGG + Intergenic
965379438 3:167969683-167969705 AACTGCCAAAAGAAAACACTGGG + Intergenic
965604919 3:170488739-170488761 AACTACCACAAGAAAACATTGGG + Intronic
965751803 3:171982761-171982783 AACTGTCTGAAGAGAACAGTGGG + Intergenic
965793900 3:172417951-172417973 AACTATTAAAAGAAAACATTGGG - Intergenic
966408863 3:179628021-179628043 AACTATTAAAAGAAAACATTGGG - Intergenic
966468623 3:180261841-180261863 AACTGTTCCAATAAAACATTGGG + Intergenic
966491810 3:180536000-180536022 AACTACTAAAAGAAAACATTAGG + Intergenic
966962234 3:184951687-184951709 AACTGACAAAAGAAAGCAGTGGG + Intronic
966973116 3:185063248-185063270 ACCTGTCAAAAGAAAACACAGGG + Intergenic
967848945 3:194067791-194067813 AACTACCAAAAGGAAACATTGGG + Intergenic
968004447 3:195230484-195230506 CACTACCAAAAGAAAACATTGGG - Intronic
968018691 3:195363997-195364019 AACTACTAAAAGAAAACATTGGG + Intronic
968349542 3:198042026-198042048 ATTTGTCCAGAGAAAACACTGGG - Intronic
968356768 3:198114232-198114254 AACTTTTACAAGAAAACATTGGG + Intergenic
1202744342 3_GL000221v1_random:85273-85295 AACTACTGAAAGAAAACATTAGG + Intergenic
969417278 4:7068856-7068878 AACAGCGCATAGAAAACATTGGG + Intergenic
970011253 4:11461911-11461933 AACTACTCAAAGAAATCATTGGG + Intergenic
971194413 4:24458197-24458219 AAATGCACAAAGAAAATATTGGG + Intergenic
971574171 4:28252997-28253019 AACTCACCAAAGAAATCATCAGG - Intergenic
971733823 4:30419925-30419947 AACTGTTAGAAGAAAACATAAGG + Intergenic
971909729 4:32780447-32780469 ATATTTCCAGAGAAAACATTAGG - Intergenic
972384012 4:38546200-38546222 AACTGCTTCAAGAAAACATTGGG - Intergenic
972702880 4:41510887-41510909 AACTTTTTAAAGAAATCATTTGG - Intronic
972753179 4:42013786-42013808 AACTATTTAAAGAAAACATTGGG + Intronic
972858609 4:43138961-43138983 AACTATTAAAAGAAAACATAAGG - Intergenic
972996716 4:44888355-44888377 AACTAATAAAAGAAAACATTGGG - Intergenic
973074649 4:45907638-45907660 AACTATTAGAAGAAAACATTTGG + Intergenic
973227620 4:47803748-47803770 AAATGCTAAAAGAAAACATTGGG + Intronic
973917028 4:55644591-55644613 AACTACTAAAAGAAAACATTAGG - Intergenic
974224662 4:59023778-59023800 AACAATTCAGAGAAAACATTTGG + Intergenic
974554619 4:63428609-63428631 AACTGAACAATGAAAACACTTGG - Intergenic
974578659 4:63764936-63764958 AACTCTCTAAAGAGAAGATTTGG + Intergenic
974867553 4:67598874-67598896 AACTACTCCAAGAAAACATTGGG - Intronic
974889038 4:67856524-67856546 AACTATTAAAAGAAAACATAGGG + Intronic
974912195 4:68136292-68136314 ATCTACCAAAAGAAAACATTGGG + Intergenic
975095105 4:70448871-70448893 AACTACTAAAAGAAAACATTGGG - Intronic
975674751 4:76815202-76815224 AACTACTAAAAGAAAACATTGGG - Intergenic
976067498 4:81205340-81205362 GACTGTCCAGAGAAAACAGCAGG - Intronic
976323420 4:83743235-83743257 AACTGCTACAAGAAAACATTGGG - Intergenic
976623606 4:87154530-87154552 AACTACTAAAAGAAAACATTGGG + Intergenic
977113340 4:92988796-92988818 AACTGACAAAGGAAAACATGTGG + Intronic
977170336 4:93753544-93753566 AACTGAACAATGAAAACACTTGG - Intronic
977385949 4:96339419-96339441 AACTACCAGAAGAAAACATTGGG + Intergenic
977625106 4:99181327-99181349 AACTACCAAAAGAAAACTTTGGG - Intergenic
977745055 4:100536796-100536818 AACTGCTACAAGAAAACATTGGG + Intronic
978076403 4:104536035-104536057 AACTATTAGAAGAAAACATTAGG - Intergenic
978637522 4:110827478-110827500 AACTGAACAAAGAGAACACTTGG - Intergenic
978933843 4:114351688-114351710 AACTACTTAAAGAAAACATTAGG - Intergenic
978966188 4:114744779-114744801 AACTACTAAAAGAAAACATTGGG + Intergenic
979012731 4:115392047-115392069 AACTGACAAAAGAAAGCAATGGG + Intergenic
979041918 4:115809162-115809184 AACTACCAGAAGAAAACATTGGG + Intergenic
979046442 4:115872154-115872176 GACTGTCCAAAGTAAACAGAAGG - Intergenic
979280424 4:118861130-118861152 AACTGTTTAAAGAAAACATTGGG - Intronic
979422448 4:120522008-120522030 AACTACCACAAGAAAACATTGGG + Intergenic
979594475 4:122519110-122519132 AACTACTAAAAGAAAACATTGGG - Intergenic
979598996 4:122565996-122566018 AACTGCTAAAAGAAAATATTGGG - Intergenic
979616775 4:122751826-122751848 AACTACTAAAAGAAAACATTGGG + Intergenic
979645712 4:123065615-123065637 AACTGATTAAATAAAACATTTGG + Intronic
979800730 4:124905443-124905465 AAATGTCTAATGAGAACATTGGG - Intergenic
980547500 4:134287131-134287153 AAAAGACCAAAGAAAACAATTGG + Intergenic
980620249 4:135291876-135291898 AACTACCAGAAGAAAACATTGGG - Intergenic
980909429 4:138980349-138980371 AAATGCACAGAGAAAACATTAGG - Intergenic
981500346 4:145444111-145444133 AACTGTCAAAAGGAAAAATTTGG + Intergenic
982340275 4:154290830-154290852 AACTGCTAAAAGAAAACATTGGG + Intronic
983165545 4:164472254-164472276 AACTGCTAAAAGAAAACATTGGG - Intergenic
983267111 4:165518946-165518968 AACTCTCCAAAGACAGGATTTGG - Intergenic
983463932 4:168062774-168062796 AACTATCAGAAGAAAACATTGGG + Intergenic
983762646 4:171431389-171431411 AACTGTCGGAAGAAAATCTTTGG - Intergenic
983767579 4:171504617-171504639 AATTATCAAAAGAAAACATAGGG + Intergenic
984360788 4:178729238-178729260 AACTATTGGAAGAAAACATTGGG - Intergenic
985236665 4:187882581-187882603 AACTGAACAATGAAAACACTTGG + Intergenic
985316708 4:188665798-188665820 AAATGTAAAAAGAAAAAATTAGG + Intergenic
1202757453 4_GL000008v2_random:77983-78005 AACTAGTGAAAGAAAACATTAGG - Intergenic
986776562 5:11019874-11019896 ATCTGTCTCAAGAATACATTTGG - Intronic
986913253 5:12584303-12584325 AACTGCAAGAAGAAAACATTGGG - Intergenic
987281264 5:16415968-16415990 AAATATCCAATGAGAACATTTGG + Intergenic
987617762 5:20298858-20298880 AACTGAAGAAAAAAAACATTTGG + Intronic
988118219 5:26924753-26924775 AACTGAACAATGAGAACATTTGG - Intronic
988932028 5:36045673-36045695 AACTACTAAAAGAAAACATTGGG + Intronic
989231324 5:39090256-39090278 AACTGCTAGAAGAAAACATTAGG + Intergenic
989302025 5:39906016-39906038 ATCTGTCCATTGAAAACATTGGG + Intergenic
989497826 5:42130269-42130291 AACTCTTGAAAGAAAACATAGGG + Intergenic
989769351 5:45125000-45125022 AACTGTCAAAAAAAAAAAGTGGG - Intergenic
989986655 5:50707712-50707734 AACTCCCCAAAGAAAACAAGAGG - Intronic
990130538 5:52577099-52577121 AGCTGGACAAAGAAAAAATTGGG - Intergenic
990400709 5:55434799-55434821 AACTAATCAAAGAAAACATAGGG + Intronic
990784548 5:59404714-59404736 AACTATTGAAAGAAAACATTGGG - Intronic
990854189 5:60244836-60244858 AACTACTGAAAGAAAACATTGGG + Intronic
990889123 5:60630042-60630064 AACTTTTAAAAGAAAACATAGGG - Intronic
992493552 5:77269573-77269595 AACCGTTAAAAGAAAACACTGGG - Intronic
993268808 5:85765901-85765923 AACTATTAAAAGCAAACATTTGG - Intergenic
993270585 5:85791108-85791130 AACTGAACAATGAAAACACTTGG - Intergenic
993569263 5:89516422-89516444 CACTGTGCAGAGGAAACATTGGG - Intergenic
994189242 5:96850139-96850161 AACTGCTAAAAGAAAACATAAGG + Intronic
994274355 5:97817526-97817548 AACTACCAAAAGAAAACATAGGG - Intergenic
994637063 5:102356780-102356802 AACTGAACAATGAAAACACTTGG + Intergenic
994660394 5:102647103-102647125 AACTGCTCCAAGAAAACATTTGG + Intergenic
994885251 5:105552763-105552785 AATGGTCCCAAGAAAACTTTGGG - Intergenic
995149361 5:108824575-108824597 AACTATCCAAAAAAGAAATTAGG - Intronic
995171611 5:109120202-109120224 AACCGCTAAAAGAAAACATTGGG - Intronic
995796001 5:115941942-115941964 AACTGAACAAAGAGAACACTTGG - Intergenic
996016512 5:118545034-118545056 AAAAGTTCAAGGAAAACATTTGG - Intergenic
996258984 5:121442282-121442304 AACTGCTAAAAGAAAACTTTGGG + Intergenic
996298748 5:121956093-121956115 AACTATTAAAAGAAAACTTTGGG - Intergenic
996452193 5:123637758-123637780 AACTGTCTGAAGAGAACATTGGG + Intergenic
996962932 5:129272632-129272654 AACTGGTCAAAGAAAATATCTGG + Intergenic
997151843 5:131504777-131504799 AACTGTCCAAGAACAACATGGGG + Exonic
997174621 5:131762148-131762170 AACTGCTAAAAGAAAACATTGGG + Intronic
997711990 5:136013470-136013492 AACTACTAAAAGAAAACATTTGG - Intergenic
997728500 5:136143814-136143836 AACTGTGCAAAAAAAACAGCTGG - Intronic
997959779 5:138311289-138311311 AACTCTTTAAAGAAAACATAGGG + Intronic
998265139 5:140662370-140662392 AATTGTAGAAAGAAAACAGTGGG - Exonic
998515033 5:142745206-142745228 AGCTATGAAAAGAAAACATTTGG + Intergenic
998724086 5:144989066-144989088 AACTGAACAATGAGAACATTTGG + Intergenic
998727599 5:145035704-145035726 AACTATCCAAAAAAGAAATTAGG + Intergenic
999579924 5:153026773-153026795 AACTATTCAAATAAAACATATGG + Intergenic
1000049680 5:157551462-157551484 AACTGCAACAAGAAAACATTGGG + Intronic
1000177855 5:158775571-158775593 AACTTCTCAGAGAAAACATTTGG + Intronic
1000259607 5:159574969-159574991 AACTGACCAGAGAGAAAATTGGG - Intergenic
1000830873 5:166099713-166099735 AACTGAACAATGAGAACATTTGG - Intergenic
1001684099 5:173579731-173579753 AATAGTCAAAAGAAAAAATTAGG + Intergenic
1002614851 5:180445284-180445306 AACTACTAAAAGAAAACATTTGG + Intergenic
1002766461 6:243875-243897 AACTAGTAAAAGAAAACATTGGG + Intergenic
1003941250 6:11029345-11029367 ATATGTTCAAAGATAACATTTGG - Intronic
1004102337 6:12626555-12626577 AACTGTAAAAAGACAGCATTTGG + Intergenic
1004123712 6:12851753-12851775 ACATGACAAAAGAAAACATTCGG - Intronic
1004146204 6:13069101-13069123 AACTTTCAAAAGAAAACAGAAGG + Intronic
1004458637 6:15815227-15815249 AACTGCTAGAAGAAAACATTGGG - Intergenic
1004633158 6:17440871-17440893 AACTGAACAAAGAGAACACTTGG - Intronic
1005877208 6:30020195-30020217 AACTGTACAATGAGAACATGGGG + Intergenic
1007087775 6:39161831-39161853 AACTCTCATAAGAAAACATCAGG + Intergenic
1007473274 6:42104366-42104388 ATCCGTCAAGAGAAAACATTTGG - Intronic
1008100403 6:47384637-47384659 AACTACTAAAAGAAAACATTGGG - Intergenic
1008445857 6:51589660-51589682 AACTGCTAAAAGAAAACATAAGG - Intergenic
1008488218 6:52057872-52057894 AACTCTTCAAAGAAAATATGGGG + Intronic
1008507254 6:52243463-52243485 AGCTGTCCAAAGTCAACACTGGG + Intronic
1008822035 6:55644496-55644518 AACTGCTACAAGAAAACATTGGG - Intergenic
1009266745 6:61565209-61565231 AACTATGAGAAGAAAACATTGGG + Intergenic
1009301503 6:62029232-62029254 AACAGTTGCAAGAAAACATTAGG + Intronic
1009329287 6:62395933-62395955 AACTACTGAAAGAAAACATTTGG - Intergenic
1009351826 6:62689994-62690016 AACTGAACAATGAGAACATTTGG + Intergenic
1009352757 6:62702631-62702653 AACTGTGAAAAGAAAACATAGGG - Intergenic
1009371652 6:62911397-62911419 AACTGCTACAAGAAAACATTAGG + Intergenic
1009373114 6:62932991-62933013 AACTGCTACAAGAAAACATTGGG - Intergenic
1009568594 6:65348812-65348834 AACTACTAAAAGAAAACATTGGG - Intronic
1009796860 6:68480437-68480459 AACTATTACAAGAAAACATTGGG + Intergenic
1010078101 6:71824959-71824981 AACAGTCCAGAGAAAGCATTTGG - Intergenic
1010158972 6:72829641-72829663 AATTGTCCAAATAATACATGTGG - Intronic
1010678256 6:78769001-78769023 AACTGCTATAAGAAAACATTGGG + Intergenic
1010837071 6:80601652-80601674 AACTCTCCAAAAAAAAAATTGGG - Intergenic
1010879542 6:81150865-81150887 AACTGAGTAAATAAAACATTTGG + Intergenic
1010995440 6:82526738-82526760 ATCTCTTAAAAGAAAACATTTGG - Intergenic
1011171920 6:84514311-84514333 TAATGTCCAAAGAAAACATTTGG + Intergenic
1011176166 6:84563102-84563124 AACTACTAAAAGAAAACATTGGG + Intergenic
1011236381 6:85222743-85222765 AACTACTAAAAGAAAACATTGGG + Intergenic
1011312775 6:85998852-85998874 AACTGAACAATGAAAACACTTGG - Intergenic
1011369675 6:86622144-86622166 AACTATTAGAAGAAAACATTGGG - Intergenic
1012297460 6:97542537-97542559 AACTACTAAAAGAAAACATTGGG - Intergenic
1012323803 6:97888010-97888032 AACTGTTGAAAGAAAATTTTTGG + Intergenic
1012491015 6:99782489-99782511 AACTCTGCCAAGAAATCATTTGG - Intergenic
1012663866 6:101941888-101941910 AACTGTCCAATTAATACTTTGGG + Intronic
1012744714 6:103071138-103071160 AACTATTACAAGAAAACATTGGG + Intergenic
1012782942 6:103586185-103586207 AACTGCTAAGAGAAAACATTAGG - Intergenic
1013036722 6:106392201-106392223 AACAAGCCAAAGAAAAGATTGGG - Intergenic
1013076399 6:106775387-106775409 AACTGTGCAAACAATACTTTGGG - Intergenic
1013078827 6:106794461-106794483 AAGAGTGCAGAGAAAACATTAGG + Intergenic
1013201384 6:107899794-107899816 AACTGTCCAAATAAAAATTTTGG - Intronic
1013378994 6:109547586-109547608 AACTGCTAGAAGAAAACATTGGG + Intronic
1013899499 6:115137383-115137405 GAGTTTCCAAAGAAAAGATTTGG + Intergenic
1014097429 6:117475858-117475880 CACTGTCCAAAAATGACATTTGG - Intronic
1014275443 6:119382624-119382646 AACTATTAAAAGAAACCATTGGG - Intergenic
1014403911 6:121024797-121024819 AACTGAACAATGAAAACACTTGG + Intergenic
1014445262 6:121519576-121519598 AACAGTTCTCAGAAAACATTTGG + Intergenic
1014648333 6:124003982-124004004 AAGTGCACAAAGAGAACATTTGG + Intronic
1015080712 6:129222543-129222565 AACTGAACAATGAAAACACTTGG - Intronic
1015183417 6:130385401-130385423 AAATGTCCAAATAAGACATCTGG - Intronic
1015293645 6:131565714-131565736 AACTGCTACAAGAAAACATTGGG - Intergenic
1015328861 6:131953831-131953853 AAATGTCAAAAGAAAGAATTTGG + Intergenic
1015370945 6:132451815-132451837 AACTTTCCAATGAAATCATCTGG - Exonic
1016347114 6:143125711-143125733 AACCGTCTAAAGAAGGCATTTGG - Intronic
1016542826 6:145185383-145185405 AACTACTAAAAGAAAACATTGGG + Intergenic
1017080133 6:150660495-150660517 GACTCTCCAAAGGAAAAATTTGG - Intronic
1017509196 6:155097755-155097777 AACGGCCAGAAGAAAACATTTGG - Intronic
1017998016 6:159550545-159550567 AACTACTAAAAGAAAACATTGGG - Intergenic
1018382762 6:163274231-163274253 AACTGAACAATGAGAACATTTGG - Intronic
1018574665 6:165247051-165247073 AACTGAACAATGAAAACACTTGG - Intergenic
1018970909 6:168528070-168528092 TTTTGGCCAAAGAAAACATTTGG - Intronic
1018990398 6:168669300-168669322 AACAGTCCAAGGAAAACACGAGG - Intronic
1019850848 7:3555465-3555487 AACTAGTAAAAGAAAACATTGGG + Intronic
1019881745 7:3867224-3867246 AACTGGCCAAAGAAAAAAATAGG + Intronic
1020331155 7:7018133-7018155 ACCAGTCAAAAGAAAACATGCGG + Intergenic
1020527988 7:9288610-9288632 AACTAATGAAAGAAAACATTGGG - Intergenic
1020843313 7:13249483-13249505 AACTCTTAAAAGAAAACATAAGG - Intergenic
1020865034 7:13549409-13549431 AACTACTGAAAGAAAACATTGGG + Intergenic
1021155273 7:17202477-17202499 AACTATCAGAAGAAAACATAGGG - Intergenic
1021357085 7:19663397-19663419 AACTATTAGAAGAAAACATTGGG + Intergenic
1021427337 7:20516699-20516721 AACTGAACAATGAAAACACTTGG + Intergenic
1021736069 7:23639079-23639101 AATTTTCAAAATAAAACATTGGG - Intronic
1021863408 7:24930274-24930296 AAATGTGCAAATAAAACATCTGG + Intronic
1022008785 7:26291515-26291537 AAATGTCTCAATAAAACATTTGG - Intergenic
1022513078 7:30954125-30954147 AACTGTTAAATGAAAACATAAGG - Intronic
1022901950 7:34819861-34819883 AACTGAACAACGAAAACACTTGG + Intronic
1023265188 7:38397554-38397576 AACTACCAAAAGGAAACATTGGG + Intronic
1023285373 7:38613753-38613775 AACGGTTCAAAGTAAACCTTAGG + Intronic
1023833673 7:44056012-44056034 AACTACTCAAAGAAAACACTGGG - Intronic
1024480127 7:49853915-49853937 AATTGAACAATGAAAACATTTGG - Intronic
1024654412 7:51437333-51437355 AACTGTTGGAAGAAAACATAGGG - Intergenic
1024816968 7:53282601-53282623 AATTGAACAAAGAAAACACTTGG - Intergenic
1024867760 7:53923140-53923162 TACTTTTAAAAGAAAACATTTGG + Intergenic
1024902147 7:54332085-54332107 AAATGTCCCAAGTAATCATTTGG - Intergenic
1025859106 7:65309868-65309890 ACCTGTGCAAGGAAAAGATTGGG + Intergenic
1025973135 7:66346924-66346946 AGCTGCTAAAAGAAAACATTTGG - Intronic
1027783104 7:82544719-82544741 AACTGTGCAAGGAAAATTTTGGG + Intergenic
1027823957 7:83087008-83087030 AACTGAACAATGAAAACACTTGG + Intronic
1027996539 7:85432872-85432894 AACTGCTACAAGAAAACATTGGG + Intergenic
1028060416 7:86306962-86306984 AACTTTACAAAGAAAGGATTAGG + Intergenic
1028161411 7:87490188-87490210 AACTGCCAAAAGAAAGCATTGGG + Intergenic
1028208800 7:88048344-88048366 AAAGGTCCAAAGAAAATAATTGG - Intronic
1028511543 7:91630600-91630622 AAATGCCCAAAGAAAGTATTTGG + Intergenic
1028574139 7:92327638-92327660 AACTGTAGATTGAAAACATTTGG - Intronic
1029725529 7:102401331-102401353 AATTTTCAAAATAAAACATTAGG + Intronic
1030098027 7:105918799-105918821 AACTCTTCAAAGAAAACACGGGG - Intronic
1030421982 7:109318485-109318507 AACTGCTGGAAGAAAACATTGGG + Intergenic
1030542459 7:110848261-110848283 AACTCACCAAAGAAAAAATATGG + Intronic
1030567359 7:111175669-111175691 AATTATTCCAAGAAAACATTGGG + Intronic
1031098904 7:117454208-117454230 AACTACTCCAAGAAAACATTGGG + Intergenic
1031271978 7:119662927-119662949 AACTATGAAAACAAAACATTGGG + Intergenic
1031288359 7:119900797-119900819 AAGTGCCCCAAGAACACATTTGG + Intergenic
1031696634 7:124864253-124864275 AAATGTGCAAAGTAAACATAAGG - Intronic
1032138233 7:129301460-129301482 AACTACCAAAAGAAAACATTGGG - Intronic
1032342094 7:131083358-131083380 GAGTGCCCAAAGAAAGCATTTGG - Intergenic
1032975579 7:137218787-137218809 AACTCTCCAAAGCACACAATTGG - Intergenic
1033386165 7:140878310-140878332 AACTCTCAGAAGAAAACATAGGG + Intronic
1034034631 7:147805892-147805914 AACTAGTAAAAGAAAACATTGGG + Intronic
1034559184 7:151868994-151869016 GACTGGCGAAAGAAATCATTTGG - Intronic
1034914968 7:155030322-155030344 AACTACTAAAAGAAAACATTGGG - Intergenic
1036112882 8:5924315-5924337 AAATGGAAAAAGAAAACATTTGG + Intergenic
1037083751 8:14820046-14820068 AATTGTCCAATTAAAACATAAGG + Intronic
1038096951 8:24323813-24323835 AGCTGTCCAAAGAAAATAAATGG - Exonic
1038570025 8:28653470-28653492 AACTCTTAAAAGAAAACATGGGG - Intronic
1039109082 8:34022258-34022280 AACTGTTCAAAGCAGATATTAGG + Intergenic
1039464001 8:37770519-37770541 AACTACTAAAAGAAAACATTGGG + Intronic
1039647055 8:39298122-39298144 AACTGCTACAAGAAAACATTGGG - Intergenic
1041882918 8:62773154-62773176 AGCTACCAAAAGAAAACATTGGG - Intronic
1042273939 8:66984013-66984035 AACTGTGCCAAGCAGACATTGGG - Intronic
1042616164 8:70652168-70652190 AACTGGCCAATGAATACATGAGG + Intronic
1042637844 8:70898010-70898032 AACTACTGAAAGAAAACATTGGG - Intergenic
1043133653 8:76493134-76493156 AACTATTAAAATAAAACATTGGG - Intergenic
1043237967 8:77892827-77892849 AATTGTATAGAGAAAACATTTGG + Intergenic
1043281919 8:78478966-78478988 AACTACTAAAAGAAAACATTGGG + Intergenic
1043365297 8:79525959-79525981 TACTGCCCAAAGAAAACATGGGG - Intergenic
1043761749 8:84076990-84077012 AACTGAACAATGAAAACACTTGG - Intergenic
1044046512 8:87441428-87441450 AACTATGAAAAGAAAACACTGGG - Intronic
1044120961 8:88394972-88394994 AACTTTTCAAAGAATACATTTGG + Intergenic
1044160282 8:88905127-88905149 AACTGTGATAATAAAACATTAGG + Intergenic
1044634982 8:94313805-94313827 AACTCCTCAAAGAAAACATTTGG - Intergenic
1044732560 8:95241412-95241434 AACTACTAAAAGAAAACATTGGG - Intergenic
1044774194 8:95670556-95670578 CTCTGTCCAGAGTAAACATTAGG + Intergenic
1044956079 8:97482310-97482332 AACTGAACAAAGAGAACACTTGG - Intergenic
1044957459 8:97496018-97496040 AACTATTAAAAGAAAACATTGGG + Intergenic
1045142747 8:99304880-99304902 AACTTTATACAGAAAACATTGGG - Intronic
1045340856 8:101253104-101253126 AAATGTACAAAGAAAAAAGTTGG - Intergenic
1045440463 8:102203582-102203604 AACTATGCAAAGAATACAGTTGG + Intergenic
1045590460 8:103588801-103588823 AACTACCACAAGAAAACATTGGG + Intronic
1045632272 8:104138865-104138887 AACTACTAAAAGAAAACATTGGG - Intronic
1045677108 8:104619408-104619430 ATCTGTCCTAATAAAACATAAGG - Intronic
1045991285 8:108311495-108311517 AACTACTAAAAGAAAACATTGGG + Intronic
1046006695 8:108494640-108494662 AACTGAACAATGAAAACACTTGG - Intergenic
1046318573 8:112539793-112539815 AACTACCAGAAGAAAACATTGGG + Intronic
1046536711 8:115523544-115523566 AACTATCCATATAAACCATTTGG + Intronic
1046743183 8:117849777-117849799 AACTGTTCCAAGAAAATTTTTGG - Intronic
1046755891 8:117972592-117972614 AACTATCAAAAGAAAGCAATTGG - Intronic
1047015685 8:120720684-120720706 ACCTCTGCATAGAAAACATTTGG - Intronic
1047410856 8:124623555-124623577 AACTGTCCAATTTAAGCATTTGG + Intronic
1048119198 8:131561119-131561141 AACTATTAGAAGAAAACATTTGG + Intergenic
1048916351 8:139187734-139187756 AACTATGGGAAGAAAACATTAGG + Intergenic
1049953151 9:665265-665287 AACTAATAAAAGAAAACATTGGG - Intronic
1050601187 9:7253193-7253215 AACTGAACAATGAGAACATTTGG - Intergenic
1050618036 9:7423527-7423549 AACTACTAAAAGAAAACATTAGG - Intergenic
1050625339 9:7498200-7498222 AACTGACTAAAGCAAAGATTGGG - Intergenic
1050996112 9:12219412-12219434 AACTGAACAATGAGAACATTTGG - Intergenic
1051465596 9:17374007-17374029 AACTACTAAAAGAAAACATTGGG + Intronic
1051685853 9:19657554-19657576 AACTGTTCAAAGAATACACAGGG - Intronic
1052355547 9:27501540-27501562 AACTGAACAATGAAAACACTTGG + Intronic
1052690074 9:31806638-31806660 AACTATTAGAAGAAAACATTGGG + Intergenic
1053232573 9:36423341-36423363 AACAGAACAAAGAAACCATTTGG + Intronic
1055287347 9:74743006-74743028 AACTGTGCAAAGTGAACAGTAGG - Intronic
1055344096 9:75315852-75315874 AACTTTCTGAAGAAAACATAAGG - Intergenic
1055387562 9:75779534-75779556 AACTACTAAAAGAAAACATTGGG + Intergenic
1056183954 9:84113365-84113387 AACTACTAAAAGAAAACATTGGG - Intergenic
1056535934 9:87527689-87527711 AACTGTCCAAAGAAAACATTAGG - Intronic
1056908119 9:90672289-90672311 ATCTGTTAAAAGAAAACTTTAGG + Intergenic
1057285960 9:93754465-93754487 AAATGTAAAAAGAAAACATTGGG - Intergenic
1057289223 9:93790012-93790034 AACTCTTAAAAGACAACATTAGG - Intergenic
1058200130 9:102028555-102028577 ATCTGTCCATAGAATACATGTGG + Intergenic
1058267825 9:102927933-102927955 AACTGAACAATGAAAACATATGG + Intergenic
1058283541 9:103148702-103148724 AACTGTAAAAAGAACAAATTAGG - Intergenic
1059030141 9:110684079-110684101 AACTACTCCAAGAAAACATTGGG - Intronic
1059110354 9:111552691-111552713 CACTGCCCAAAGAAAACTCTGGG - Intronic
1059189778 9:112313909-112313931 AACTGACGACGGAAAACATTTGG + Intronic
1059792692 9:117657761-117657783 AACTGAACAATGAAAACACTTGG - Intergenic
1060124416 9:121028634-121028656 AACTGAACAATGAAAACACTTGG + Intronic
1061956623 9:133966174-133966196 AACTACTGAAAGAAAACATTGGG + Intronic
1203753569 Un_GL000218v1:102785-102807 AACTACTGAAAGAAAACATTAGG + Intergenic
1203461126 Un_GL000220v1:39346-39368 AACTTCTGAAAGAAAACATTGGG - Intergenic
1203463383 Un_GL000220v1:64296-64318 AATTGACCAAAGAGAACATATGG - Intergenic
1203370118 Un_KI270442v1:295539-295561 AACTTTTACAAGAAAACATTGGG - Intergenic
1203712974 Un_KI270742v1:115222-115244 AACTACTGAAAGAAAACATTAGG + Intergenic
1203538242 Un_KI270743v1:62846-62868 AACTAGTGAAAGAAAACATTAGG - Intergenic
1185996593 X:4957837-4957859 AACTGAACAATGAGAACATTTGG + Intergenic
1186547524 X:10466030-10466052 AACCGGAAAAAGAAAACATTTGG - Intronic
1186813431 X:13212323-13212345 AACTGTGCCAAGAATCCATTTGG - Intergenic
1186976081 X:14906281-14906303 AACTGACCATAATAAACATTAGG - Intronic
1187365449 X:18662502-18662524 AACTGAACAATGAAAACACTTGG - Intronic
1187594019 X:20750975-20750997 AACTGCTGAAAGAAAACACTGGG - Intergenic
1188094466 X:26004476-26004498 AACTACCATAAGAAAACATTGGG + Intergenic
1188558689 X:31442714-31442736 AAATGTCCAAAGAAAACCAATGG - Intronic
1188773698 X:34186999-34187021 AACTACTAAAAGAAAACATTGGG - Intergenic
1190532244 X:51391107-51391129 AACTACTGAAAGAAAACATTGGG + Intergenic
1190583554 X:51913606-51913628 AACTACTAAAAGAAAACATTGGG - Intergenic
1191971234 X:66818798-66818820 AACTGCTACAAGAAAACATTGGG + Intergenic
1192070359 X:67933420-67933442 AACTACTAAAAGAAAACATTGGG + Intergenic
1192091818 X:68166923-68166945 AACTACTAAAAGAAAACATTGGG + Intronic
1192198016 X:69044567-69044589 AATTGTCCAGTGAAACCATTTGG + Intergenic
1192291376 X:69799228-69799250 AACTACTAAAAGAAAACATTGGG + Intronic
1192635864 X:72816599-72816621 AACTACTAAAAGAAAACATTAGG - Intronic
1192645850 X:72904204-72904226 AACTACTAAAAGAAAACATTAGG + Intronic
1192852745 X:74975050-74975072 AACTACTAAAAGAAAACATTAGG - Intergenic
1193051761 X:77109118-77109140 AAATGTCCAAGGATAACAGTTGG + Intergenic
1193159417 X:78211205-78211227 AACTGCTACAAGAAAACATTGGG - Intergenic
1193412843 X:81184725-81184747 AACTACTGAAAGAAAACATTGGG - Intronic
1193881857 X:86933024-86933046 AACTGACAAAAGAAAACCTTTGG - Intergenic
1194069529 X:89304126-89304148 AATTATCATAAGAAAACATTGGG - Intergenic
1194182938 X:90735919-90735941 AGATGTCCCAAGAAAAAATTGGG + Intergenic
1194348811 X:92799667-92799689 AACTACCAAAAGAAAACTTTGGG + Intergenic
1194418857 X:93648158-93648180 AACTACTGAAAGAAAACATTGGG + Intergenic
1194460117 X:94156102-94156124 AAGTATTAAAAGAAAACATTGGG - Intergenic
1194591913 X:95809801-95809823 AACTATCCAAATAAAACACAGGG + Intergenic
1194624054 X:96207831-96207853 AACTGCTACAAGAAAACATTGGG + Intergenic
1194669956 X:96719384-96719406 AACTGTTACAAGAAAACATTGGG - Intronic
1194865870 X:99065906-99065928 AACTCCTGAAAGAAAACATTAGG + Intergenic
1194925774 X:99821164-99821186 AACTACTGAAAGAAAACATTGGG + Intergenic
1195848764 X:109259045-109259067 AACTACTAAAAGAAAACATTGGG - Intergenic
1195929233 X:110056826-110056848 ATCTCTCCAAAGAAAACACACGG - Intronic
1195978414 X:110552785-110552807 AACTGTACAAAGAATGCTTTGGG + Intergenic
1196232066 X:113235250-113235272 AACTAGCACAAGAAAACATTGGG - Intergenic
1196274155 X:113747185-113747207 AAATGTCAAAAGAATTCATTAGG + Intergenic
1196361609 X:114867605-114867627 AACTATTGCAAGAAAACATTGGG - Intronic
1196639722 X:118044779-118044801 AACTTCTAAAAGAAAACATTGGG + Intronic
1197018800 X:121660630-121660652 AATTGTTAGAAGAAAACATTTGG + Intergenic
1197163278 X:123347396-123347418 AAAGGCCCAAAGAACACATTAGG + Intronic
1197178393 X:123508686-123508708 AACTGACCAATGAGAACACTTGG + Intergenic
1197360704 X:125499432-125499454 AACTACCAAAAGAAAACTTTGGG - Intergenic
1197435182 X:126419188-126419210 AACTACCACAAGAAAACATTAGG - Intergenic
1197493610 X:127150667-127150689 AACTCTTAAAAGAAAACATAGGG - Intergenic
1197508354 X:127337507-127337529 AACTGCTAAAAGAAAACATTGGG - Intergenic
1197736577 X:129853850-129853872 AACTGACCAATGAGAACACTTGG - Intergenic
1198162464 X:134021217-134021239 AGCTTTCCACAGAAAACACTGGG - Intergenic
1198455397 X:136812676-136812698 AAATGACTAGAGAAAACATTAGG + Intergenic
1198465405 X:136900498-136900520 AACTTTTAAAAGAAAACATAGGG - Intergenic
1198570664 X:137952357-137952379 AACTATTACAAGAAAACATTGGG - Intergenic
1198654880 X:138902667-138902689 AACTCTGCAAAGAAAACTCTTGG + Intronic
1199041664 X:143121656-143121678 GTCAGTCCAAAGAAAACATCTGG - Intergenic
1199163564 X:144643937-144643959 AACTAGCAGAAGAAAACATTTGG + Intergenic
1199246147 X:145606643-145606665 AACTGCTAAAAGAAAACATTGGG + Intergenic
1199441453 X:147872961-147872983 AACTATTGCAAGAAAACATTGGG + Intergenic
1199915760 X:152338630-152338652 AACTGTTGGAAGAAAATATTGGG - Intronic
1199921495 X:152409414-152409436 AACTATTGAAAGAAAACATTAGG + Intronic
1200333993 X:155328998-155329020 AACTACTAAAAGAAAACATTAGG + Intronic
1200723679 Y:6638269-6638291 AATTATCATAAGAAAACATTGGG - Intergenic
1201068182 Y:10119551-10119573 AACTTTTACAAGAAAACATTGGG + Intergenic
1201167212 Y:11220344-11220366 AACTACTGAAAGAAAACATTAGG + Intergenic