ID: 1056535936

View in Genome Browser
Species Human (GRCh38)
Location 9:87527724-87527746
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056535934_1056535936 12 Left 1056535934 9:87527689-87527711 CCTAATGTTTTCTTTGGACAGTT No data
Right 1056535936 9:87527724-87527746 GCTTCTTTCTGAACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type