ID: 1056536191

View in Genome Browser
Species Human (GRCh38)
Location 9:87529803-87529825
Sequence CTGTTCTAGGGGCAGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056536191_1056536197 3 Left 1056536191 9:87529803-87529825 CCTGTCACCTGCCCCTAGAACAG 0: 1
1: 0
2: 2
3: 13
4: 152
Right 1056536197 9:87529829-87529851 AGACCTGTTCTGTTGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056536191 Original CRISPR CTGTTCTAGGGGCAGGTGAC AGG (reversed) Intronic
902260408 1:15220963-15220985 CAGTTCTGGGGGCAGAGGACAGG - Intergenic
902798743 1:18816460-18816482 CTGATGCAGGGGCAGTTGACAGG - Intergenic
906537028 1:46556704-46556726 CTTCACTTGGGGCAGGTGACGGG - Intergenic
907035313 1:51211099-51211121 CCTGTCTAGGGGCAGGTGAAAGG + Intergenic
909920187 1:81371960-81371982 CTGTTGTAGGTACAGTTGACAGG + Intronic
915615430 1:157034218-157034240 TTGTTCTGGGGGGAGGTGGCTGG - Intronic
920201783 1:204263969-204263991 CTCTTCTGTGGCCAGGTGACTGG + Intronic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
922469038 1:225864254-225864276 CTGTTCTAGGTGCTGGTAACAGG + Intronic
923243309 1:232106865-232106887 CTGTGCTTGGGGCTGGTCACTGG + Intergenic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1067066140 10:43105339-43105361 CTGTCCTAGGGGGAGGGGAAGGG + Intronic
1068041118 10:51825587-51825609 CTGTTGTAGGCACAGGAGACTGG - Intronic
1068663450 10:59647521-59647543 CTGATCTAGGTGGAGGAGACAGG + Intergenic
1073542255 10:104323823-104323845 CAGATCCAGGGGCAGGTGCCTGG - Intronic
1073627217 10:105111785-105111807 CTCTTCTAGGGTCAGGTGAAAGG - Intronic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074769359 10:116723404-116723426 TTCTTCCAGGGGCAGGGGACGGG + Intronic
1076921566 10:133457152-133457174 CAGCTTCAGGGGCAGGTGACCGG - Intergenic
1077301300 11:1848374-1848396 CTCTGCTAGGGGCAGCTGTCTGG + Intergenic
1077496880 11:2890803-2890825 CTGTTCTTGGGGCGGCTGCCAGG + Intronic
1078094387 11:8287726-8287748 CTGTTCAGGAGGCTGGTGACAGG + Intergenic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1084383996 11:68830649-68830671 CTGGCGGAGGGGCAGGTGACAGG - Intronic
1085643297 11:78207015-78207037 TTGCTCTAGGGGCAGGGGCCAGG + Intronic
1086172614 11:83852906-83852928 CTGCTCTAAGGGCAGGAGTCTGG - Intronic
1090627960 11:128622297-128622319 ATGTTCTTGGGGCAGATGAACGG + Intergenic
1090654163 11:128830004-128830026 ATATTCTTGGGGCAGCTGACAGG - Intergenic
1092001824 12:5039031-5039053 CTGTGCTGGGGACAGGTGGCTGG - Intergenic
1095854285 12:46843550-46843572 CTGGTCTATGGGCATGTGAGAGG - Intergenic
1100347363 12:93745509-93745531 CTGTGCTATGGGGAAGTGACTGG + Intronic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1105642189 13:22277110-22277132 TTGGTCTAGAGGCAGGTGAGGGG - Intergenic
1110531571 13:76604215-76604237 CAGTTCTAAGGGCAGTTGTCTGG + Intergenic
1110830532 13:80025576-80025598 CTGCTGTAAGGGCAGATGACTGG + Intergenic
1113635130 13:111914298-111914320 CTGTTCTAGAGGCAAGTGCCAGG - Intergenic
1116011132 14:39353711-39353733 CTGTTATAGGGTCAGGGGAGAGG - Intronic
1116131047 14:40855973-40855995 CTGTTATAGGGGCAGCTGAGAGG - Intergenic
1119073073 14:71607158-71607180 GAGTTCCAGGGGGAGGTGACAGG + Intronic
1121337835 14:93088039-93088061 CTGTTTTAGGGTCAGGTGCCTGG - Intronic
1121584752 14:95055578-95055600 CTGTACAAGGAGCAGGTGATGGG + Intergenic
1122171149 14:99876728-99876750 CTGTTCTAGGGCCAGGGCTCTGG - Intronic
1122869069 14:104626412-104626434 GGGTCCTGGGGGCAGGTGACAGG + Intergenic
1124553826 15:30707887-30707909 CTGTTCAGGTTGCAGGTGACTGG + Intronic
1124677423 15:31697785-31697807 CTGTTCAGGTTGCAGGTGACTGG - Intronic
1128220913 15:65967911-65967933 CTGCTCCAGGGGCTGGGGACAGG - Intronic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1129429353 15:75487547-75487569 CTGTTCTAGGTACTGGAGACAGG + Intronic
1133905755 16:10021074-10021096 CCTTTCAGGGGGCAGGTGACTGG + Intronic
1134040855 16:11067334-11067356 CTGTTCTAAGAGCAGGTGACGGG + Intronic
1134339988 16:13335991-13336013 CTGTTCTAGGGCCAGATGGGCGG - Intergenic
1138451316 16:57094783-57094805 CTGTTCTAGGGGCAGGGGCCTGG + Intronic
1141357987 16:83366652-83366674 GTGTTCTAGGTGTAGGTGTCAGG - Intronic
1143427596 17:6852590-6852612 ATGTTCTAGGGGCAGGGAGCGGG + Intergenic
1145000530 17:19301674-19301696 CTGTTCTGAGAGCAGGGGACAGG - Intronic
1147310926 17:39595844-39595866 CTGGTGGAGGGGCAGGTGCCAGG + Intergenic
1147327562 17:39676881-39676903 CAGTTCTATGGGAAGCTGACGGG - Intronic
1148336877 17:46847854-46847876 CTGGCCTGGGGGCAGGTGCCGGG + Intronic
1150230503 17:63547151-63547173 CTGATCTAGGTGCTGGTTACAGG + Intronic
1157451935 18:47795489-47795511 CGGGTCTAGGGGTAGGGGACTGG - Intergenic
1157733423 18:50024635-50024657 CTGTAATAGGGGCAGGAGCCAGG + Intronic
1159846622 18:73468914-73468936 CTGTTGTGGGGTCAGGGGACAGG - Intergenic
1159975852 18:74711334-74711356 CTGTTTTAAGGTCAGCTGACTGG - Intronic
1161397660 19:4052937-4052959 CTGTTCTAGGCGCCGGGGACAGG - Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1166752201 19:45169681-45169703 CTGTTCTAGGTGCTGGCTACAGG - Intronic
1166947167 19:46404402-46404424 CTGTTCTAGGTGCAAGAAACAGG + Intergenic
1166959574 19:46489499-46489521 CTGTTCTTGGTGCAGGAAACAGG - Intronic
1166985079 19:46654857-46654879 CTGTTCTAGGGGGATGGGAGAGG - Intronic
925103430 2:1268978-1269000 CTCATCTATGGGAAGGTGACAGG + Intronic
926141872 2:10372772-10372794 CTGTCCTTGGGGCAGGGAACAGG - Intronic
927937279 2:27082967-27082989 CTGTTGGAGGAGCAGGTGGCAGG + Exonic
928092430 2:28383182-28383204 CTGTAGCAGGGCCAGGTGACAGG - Intergenic
929321115 2:40544480-40544502 CTGTTCTTGGGTCAGATTACTGG + Intronic
929949247 2:46393711-46393733 CTGTGCTCGGGGCATGGGACTGG + Intergenic
933807892 2:86013208-86013230 CTGTTCTAGGGGACAGTGGCAGG + Intergenic
937124069 2:119462082-119462104 GTGTTGTAGGGGCAGGAGCCAGG + Intronic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
940010027 2:149042627-149042649 CTGTTCTAGGTGCTGGGGATTGG + Intronic
942337826 2:174909377-174909399 CTGTTCTAGGAGCAGATGCTAGG + Intronic
949075333 2:242054117-242054139 CTGTTTACGGAGCAGGTGACAGG - Intergenic
1174385681 20:50187455-50187477 AGGTTCTGAGGGCAGGTGACTGG + Intergenic
1175700399 20:61132741-61132763 ATGTTCTAGTGGAAGGAGACAGG - Intergenic
1177939579 21:27392108-27392130 CTGTGCTAGGTGCTGGAGACAGG - Intergenic
1182258451 22:29054776-29054798 CCTTTCTGGGGGCATGTGACTGG + Exonic
1183107805 22:35627438-35627460 GTGTTCAAGGGGCATGTGCCTGG + Intronic
1184293545 22:43510297-43510319 CTCTTGGAGGGGCAGGTGACAGG - Intergenic
1184471032 22:44696525-44696547 CAGTTCTAGGGGCCGGGGAGGGG - Intronic
1184645531 22:45892768-45892790 CTGGTCTATGGGCAGTTGCCAGG - Intergenic
1184889446 22:47370838-47370860 CTGCTGTGGGGGCAGGTGCCAGG + Intergenic
1184987000 22:48142517-48142539 CTGTTTCAGGGGCTGGTGACGGG + Intergenic
1185214288 22:49589718-49589740 CTGTGCTGGGGGCAGGAGATGGG + Intronic
950091360 3:10297560-10297582 CTGTTGTGGGGGGAGGGGACGGG - Intronic
951442086 3:22735309-22735331 TTGATTTAGGGGCAGGAGACAGG - Intergenic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
953249719 3:41233692-41233714 CTGTCCTTCGGGCTGGTGACAGG + Exonic
954758884 3:52860023-52860045 CTGTTCTAGGGAAAGGGGATAGG - Intronic
955022787 3:55137028-55137050 CTGCTCTGGGGTCAGGTGTCAGG - Intergenic
956141561 3:66151594-66151616 CTGTTCTTGTGGCAGCTCACTGG + Intronic
957228476 3:77479428-77479450 CTGTTCTTGGGGCAAGTGGAGGG + Intronic
960974065 3:123158500-123158522 GTGTTTTATGGGCAGATGACTGG + Intronic
961161198 3:124727801-124727823 ATGTTCTAGGGCCAGGTCAGTGG - Intergenic
961188839 3:124940237-124940259 TTGTTCTAGGTGCAGGGAACAGG + Intronic
961616641 3:128188038-128188060 TTGTTCTGGGGGCAGCAGACAGG + Intronic
962843987 3:139259482-139259504 CTGTTCTAGTGCCAAGTGTCTGG + Intronic
967138928 3:186536778-186536800 CTGTTCTGGGTGTGGGTGACAGG + Intergenic
969995978 4:11313687-11313709 CTGTTCTAGGAGCAGGAGTGCGG + Intergenic
970906300 4:21220403-21220425 CTGTTATGGGGTCAGGAGACGGG + Intronic
979693683 4:123587607-123587629 ATGTTCTGGGGGCAGGTGGGTGG + Intergenic
985440604 4:189980683-189980705 CTGTTCTAGGAGCAGGAAAAGGG - Intergenic
986448498 5:7844193-7844215 GTTTTCCAGGGGCAGGTCACTGG + Intronic
986683184 5:10251628-10251650 CTTTTCCAGGGGGAGGTGATAGG + Intronic
986686510 5:10279515-10279537 CTGTTCAAGGACCAGCTGACAGG - Exonic
992225680 5:74618120-74618142 CAGGTATAGGGGCAGGTGAGGGG - Intergenic
992603681 5:78433482-78433504 CTGTGGTGGGGGCAGGTGTCAGG + Intronic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
997353224 5:133245562-133245584 CTGTTCTGGGGGCAAGAGAAAGG - Intronic
997366498 5:133328707-133328729 CTGCTCTTGGGGCTGGTGACAGG - Intronic
999252810 5:150192632-150192654 CTGCTCCAGGGGCAGGAGATAGG - Intronic
1002195431 5:177498368-177498390 CTGTCCTAGGAGGAGGTGATGGG - Intergenic
1005656445 6:27943460-27943482 CTGCTCTGGGGTCAGGTGTCAGG - Intergenic
1005970318 6:30755938-30755960 TTCTTCAAGGGGCAGGTTACTGG - Intergenic
1006373736 6:33660290-33660312 CTGTTAGAGGGACAGGTGACAGG + Intronic
1006389275 6:33748990-33749012 CTCTTCCAGGGCCAGGTAACCGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1008046177 6:46853886-46853908 GTGTTCTCGGGGCAGGTTTCCGG - Exonic
1015455699 6:133424455-133424477 CTGATCTTGGAGCAGGTGCCAGG + Intronic
1024231893 7:47369099-47369121 CTGCTCTTGTGGCAGGTGAAGGG + Exonic
1024317498 7:48035364-48035386 CTGGGCTACGGGCAGTTGACAGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1029515539 7:101020928-101020950 CTTCTCTGGGGGCAGGTGAGGGG - Intronic
1029548430 7:101223542-101223564 CTGTTGGAGGAGCAGGTGAGAGG + Exonic
1033567872 7:142597405-142597427 CTGTTTTATGGGCAGGGGGCAGG - Intergenic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1035105186 7:156436223-156436245 CTTTTGTAGGGGTAGGTGAGGGG - Intergenic
1038534345 8:28343202-28343224 CCCTTCTAGGGGCAGGTGAAAGG + Exonic
1042723839 8:71851030-71851052 CTGTACTACGTGCTGGTGACAGG + Intronic
1044682890 8:94799829-94799851 ATGATCTAAGGGAAGGTGACAGG + Intergenic
1048229747 8:132626698-132626720 CTATTCTAGGGAGAGGTGAGGGG - Intronic
1048984862 8:139729957-139729979 CTGTTCTGGGGGCAGGCTTCTGG - Intergenic
1049039949 8:140105037-140105059 CAGTCCTGGGGGCAGGTGGCTGG - Intronic
1049057624 8:140251230-140251252 GTGTTCCAGGGGCAGGTGCTGGG + Intronic
1049174772 8:141185074-141185096 CTGCTGTAGCAGCAGGTGACTGG - Intronic
1050404310 9:5291951-5291973 CTATGCTAGGCACAGGTGACTGG + Intergenic
1053123707 9:35563327-35563349 CAGACCTATGGGCAGGTGACTGG - Exonic
1056536191 9:87529803-87529825 CTGTTCTAGGGGCAGGTGACAGG - Intronic
1057328945 9:94094383-94094405 CTGTTCTGGGGTCAGGGGTCAGG + Intronic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1060005887 9:119998971-119998993 CTGTTAGAGGGGGAGGAGACTGG - Intergenic
1060493698 9:124102670-124102692 CTGCTCTCCTGGCAGGTGACAGG + Intergenic
1061407028 9:130398227-130398249 CTGTTGGAGGGGGAGGAGACTGG - Intronic
1061872266 9:133527351-133527373 CTGGGCTAGGGGCTGGGGACAGG - Intronic
1062741720 9:138178951-138178973 CTGTTCTAGGAGCAGGAAAAGGG + Intergenic
1187417882 X:19108802-19108824 TTGATCTGGGGGCTGGTGACAGG + Intronic
1187711374 X:22057884-22057906 CAGTTGTGGGGGCAGCTGACTGG + Intronic
1188056549 X:25547738-25547760 CTCTTCTAATGGCAGATGACAGG + Intergenic
1192351965 X:70363391-70363413 CTGTTGTGGGGTCAGGGGACGGG - Intronic
1192965536 X:76173177-76173199 CTGTTCTGGGGTCGGGTGAGTGG + Intronic
1194063498 X:89234155-89234177 CTGTTCTAGGTGCTGGTGATTGG - Intergenic
1195091147 X:101460287-101460309 CTGTTCTAAGGACCAGTGACTGG - Intronic
1196162649 X:112502737-112502759 CTGCTCTGGGGTCAGGTGTCAGG - Intergenic
1196236223 X:113283858-113283880 CTGTTGTAGTGGCAGGTGTGGGG + Intergenic
1196348808 X:114701269-114701291 CTGTTCGGGGGTCAGGTGTCAGG - Intronic
1199399221 X:147377054-147377076 CTATCCTAGGGGCATGTGAAAGG + Intergenic
1200228986 X:154434715-154434737 TTGCTCAAGGGGGAGGTGACAGG - Intronic
1200717671 Y:6568262-6568284 CTGTTCTAGGTGCTGGTTATTGG - Intergenic
1202085897 Y:21136344-21136366 CTGTTCTAGAGTCAGGTGTAGGG + Intergenic