ID: 1056538692

View in Genome Browser
Species Human (GRCh38)
Location 9:87553008-87553030
Sequence ATGGATACACAGTTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1362
Summary {0: 1, 1: 5, 2: 49, 3: 303, 4: 1004}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056538692_1056538694 16 Left 1056538692 9:87553008-87553030 CCAAGCTGAAACTGTGTATCCAT 0: 1
1: 5
2: 49
3: 303
4: 1004
Right 1056538694 9:87553047-87553069 TTCCTTCTCCTCCTAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056538692 Original CRISPR ATGGATACACAGTTTCAGCT TGG (reversed) Intronic
900415672 1:2533432-2533454 ATGGGGACAGAGGTTCAGCTTGG - Intergenic
901150474 1:7097880-7097902 ATGGGTACAGCGTTTCAGCTGGG + Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
901389095 1:8931538-8931560 ATGGATACGGGGTTTCAGATTGG - Intergenic
902078701 1:13806454-13806476 ATGGAGAGACAGTTTCATTTTGG - Intronic
903505408 1:23831247-23831269 ATGGGTACAGAATTTCAGTTTGG + Intronic
903776189 1:25795419-25795441 ATGGGTACAAAGTTTCTTCTGGG - Intergenic
903820587 1:26099549-26099571 ATGGATACAGAGTTGCAGTTTGG + Intergenic
903926220 1:26832622-26832644 ATGGAGACCCAGCTTCAGCTGGG - Intronic
903944628 1:26954093-26954115 ATGGGTAGGGAGTTTCAGCTGGG + Intronic
904112536 1:28137599-28137621 ATGGGTACAAAGTTTCAATTTGG - Intergenic
904124270 1:28225578-28225600 GTGGATACAGAGTTTCTGGTTGG + Intronic
904173636 1:28609860-28609882 ATGGATATAGAGTTTCAGTTTGG - Intronic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904367836 1:30027618-30027640 ATGGATACAAAGTTTCAGTGTGG + Intergenic
904451312 1:30614408-30614430 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
904631356 1:31844916-31844938 ATGGGTACACAGTTTCAGTTGGG - Intergenic
905160738 1:36031648-36031670 ATGGATAAAGAGTTTCAGTTTGG - Intronic
905383793 1:37584679-37584701 ATGGGTACAGGGTTTCAGTTTGG + Intronic
905671972 1:39797506-39797528 ATGGATACACAGTTTCAGTTTGG + Intergenic
905836624 1:41129320-41129342 ATAGGTACAGAGTTTCAGTTGGG - Intronic
905930302 1:41782335-41782357 ATGGGTACAGGGTTTCAGTTTGG + Intronic
906466736 1:46087979-46088001 ATGGGTATAGAGTTTCAACTGGG + Intronic
906724179 1:48031779-48031801 ATGGATACAGAGTTTCTGTTTGG + Intergenic
907002503 1:50875817-50875839 AAGGATACAAAATTTCAGTTAGG - Intronic
907177873 1:52542217-52542239 ACGGGTACAGAGTTTCAGCTTGG + Intronic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907653297 1:56317225-56317247 ATGGATACAAAGTTTCAGTTTGG + Intergenic
907724198 1:57003653-57003675 ATGGGTACAGAGTTTCTGTTTGG - Intronic
907736722 1:57120575-57120597 ATAGGTACAGAGTTTCAGTTTGG - Intronic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
908266382 1:62383442-62383464 ATGGGTACAGAATTTCAGTTTGG + Intergenic
908330461 1:63065716-63065738 ATGGTTACACAGTTTTGGTTTGG + Intergenic
908345732 1:63230419-63230441 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
908384333 1:63626833-63626855 ATGGACACAGACTTTCAGTTTGG - Intronic
908586316 1:65573781-65573803 ATGGATATAAAGTTTCAATTTGG + Intronic
908631301 1:66111381-66111403 ATGGGTAAAGAGTTTCAGTTTGG - Intronic
908876087 1:68678025-68678047 AAGGATACAAAGTTTCATTTAGG - Intergenic
909242604 1:73234293-73234315 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
909670249 1:78180535-78180557 ATGGGTACAGAGTTTCAATTTGG - Intergenic
909736024 1:78962560-78962582 ATCAATATAAAGTTTCAGCTTGG - Intronic
910097766 1:83543155-83543177 ATGGAAACACACTTGCTGCTAGG - Intergenic
910267356 1:85351835-85351857 ATGGATAGGAAGTTTCAGTTTGG + Intronic
910292189 1:85610146-85610168 ATGGGTACTGAGTTTCAGTTTGG - Intergenic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
910329367 1:86052602-86052624 TTGGGTACAGAGTTTCAGTTTGG + Intronic
910563403 1:88617364-88617386 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
911018855 1:93366049-93366071 ATGAATACATAATTTCAGTTTGG - Exonic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911300050 1:96161442-96161464 ATGGATACAAAGTTTCTTTTGGG + Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911553456 1:99312982-99313004 ATGCACACACAATTTTAGCTGGG - Intergenic
911659095 1:100480109-100480131 ATGGGTACAAAGTTTCTGTTTGG - Intronic
911815079 1:102339272-102339294 ATGGATACAGAGTCTCAGCTTGG - Intergenic
912053976 1:105570995-105571017 AATGATACAAAGTTTCAGTTAGG + Intergenic
912178548 1:107190186-107190208 ATGGGCACAGAGTTTCAGTTTGG + Intronic
912404911 1:109429022-109429044 ATGGGTACACCATTTCAGTTTGG + Intergenic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912586723 1:110773574-110773596 ATGTGTACACAGTTTCAGTCTGG + Intergenic
912871347 1:113310047-113310069 AAGGATATACAGTTTGACCTGGG - Intergenic
912877919 1:113381082-113381104 AATGATACACTGTTTCAGTTAGG - Intergenic
912883733 1:113447026-113447048 ATGGGTAAACAGTTTCATTTTGG + Intronic
913136699 1:115897843-115897865 ATGGAGACAGATTTTCAGCCCGG + Intergenic
913313541 1:117529887-117529909 ATGGTTACAGAGTTTCTGTTTGG - Intergenic
914224665 1:145710265-145710287 ACGGCTACACAGTTTCACTTTGG - Intergenic
914340987 1:146760311-146760333 CTGGGTACAGAGTTTCAGTTCGG + Intergenic
914426190 1:147579159-147579181 ATGAAAACCAAGTTTCAGCTGGG - Intronic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
914941417 1:152026430-152026452 ATGGATGCAGACTTTCAGTTTGG + Intergenic
914973916 1:152340014-152340036 ATGGATACAGAGTTTCAGCTTGG + Intergenic
915159474 1:153907522-153907544 ATATATACAAAGTTTCAGTTTGG + Intronic
915594936 1:156891506-156891528 ATGGGTACAGAGTTGCAGTTTGG + Intergenic
915707641 1:157861729-157861751 ATGGGCACAGAGTTTCAGTTTGG + Intronic
916221364 1:162448082-162448104 AAGGATACACAATTTCAATTAGG + Intergenic
916332707 1:163635583-163635605 ATGGCTACAAGGTTTCAGTTGGG - Intergenic
916617729 1:166459942-166459964 ATGAGTACAAAATTTCAGCTAGG - Intergenic
916841526 1:168606573-168606595 ATGGGTACAGAGTTTCTGTTAGG + Intergenic
916936944 1:169638693-169638715 AAGGATACAGAGTCTCAGTTAGG + Intergenic
916991103 1:170246396-170246418 AAGGATACAAAATTTCAGTTAGG + Intergenic
917515473 1:175704075-175704097 ATGGATACAGCATTTCAGTTTGG + Intronic
917601631 1:176580114-176580136 AAGGATACAGAATTACAGCTAGG - Intronic
917931486 1:179825723-179825745 ATGGTTCCAGAGTTTCTGCTTGG - Intergenic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918073409 1:181150630-181150652 ATGGTTATACAGTCTGAGCTGGG + Intergenic
918394914 1:184103725-184103747 ATGGATACAGAGTTTAATTTTGG - Intergenic
918452915 1:184676945-184676967 AAGGATACAAAATTACAGCTAGG + Intergenic
918578609 1:186097376-186097398 ATGGATACACAGTTGGCCCTCGG - Intronic
918652385 1:186981687-186981709 ATGGTTACAGAGTTTTAGTTTGG - Intronic
918914112 1:190612896-190612918 ATGAACACACAATTTCAGTTGGG + Intergenic
918966073 1:191350125-191350147 ATAGGTACAGAGTTTCAGCATGG + Intergenic
919312726 1:195931810-195931832 AAGTAGACACAGTCTCAGCTAGG + Intergenic
919581504 1:199380895-199380917 ATGGGTATGCAGTTTCATCTGGG - Intergenic
919870309 1:201815620-201815642 AAGGATACAAAATTTCAGTTAGG + Intronic
919900248 1:202038948-202038970 ATGGGTACAGAGTTGCAGTTAGG + Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920175083 1:204095788-204095810 ATGGGAACAGAGTTTCAGTTTGG - Intronic
920410066 1:205752211-205752233 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
920416732 1:205804002-205804024 ATAGGTACAGAGCTTCAGCTGGG + Intronic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
920824000 1:209407727-209407749 ATGGGTATAGAGTTTCAGGTTGG - Intergenic
920991587 1:210944877-210944899 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
921020576 1:211231351-211231373 AAGGATACAAAATTTCAGTTAGG - Intergenic
921218540 1:212956986-212957008 ATGGATACAAGGTTTCAGTTAGG - Intronic
921427194 1:215017615-215017637 AAGGATACAAAATTTCAGTTAGG + Intronic
922090131 1:222387975-222387997 AAGGATACACATTTTCAGTTAGG - Intergenic
922205922 1:223446208-223446230 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
922209024 1:223472935-223472957 ATGGATACAGAGTTTCTGTTAGG - Intergenic
922295000 1:224242172-224242194 ATGGGGACAGAGTTTCAGTTTGG + Intronic
922996766 1:229970463-229970485 ATGGATACAGGGTTTCAGTTTGG + Intergenic
923069223 1:230547594-230547616 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
923205101 1:231751588-231751610 ATGGGTACAGAGTGTCAGTTGGG - Intronic
923651890 1:235881889-235881911 ATGGGTACAAAATTTCAGCTGGG + Intronic
923720575 1:236463691-236463713 ATGGGTACAGAATTTCAGTTTGG - Intronic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
924600577 1:245485235-245485257 ATGGGTACAGAGCTTCAGTTTGG + Intronic
1062763104 10:42323-42345 GTGGATACAGAGTTTCACTTTGG + Intergenic
1062947621 10:1473325-1473347 ATGGATACAAATTTGCTGCTGGG + Intronic
1062949018 10:1482542-1482564 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1062993186 10:1839577-1839599 ATAGATACACAGATTTAGATTGG + Intergenic
1063175781 10:3549786-3549808 AAGGATACAGAATTTCAGTTAGG - Intergenic
1063521568 10:6746193-6746215 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1063618729 10:7625379-7625401 ATGGGTACAAAGTTTCAGTTTGG + Intronic
1064015727 10:11770749-11770771 ATGGGTACAGAGTTTCATTTGGG - Intergenic
1064091884 10:12392757-12392779 AAGGATACAAAATTTCAGCTGGG - Intronic
1064094089 10:12409822-12409844 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1064318722 10:14281698-14281720 ATGGGTATGGAGTTTCAGCTGGG - Intronic
1064590733 10:16888111-16888133 CAGGATACAAAATTTCAGCTAGG + Intronic
1064615277 10:17147520-17147542 ATGGATACAAAGTTTCTGATTGG - Exonic
1064634685 10:17351913-17351935 AAGGGTACAAAGTTTCAGTTGGG + Intronic
1064735675 10:18379613-18379635 ATGGGCACAGAGTTTCAGCCAGG - Intronic
1065415440 10:25480455-25480477 ATGAATACAGAGTTTTAGCTTGG - Intronic
1065786548 10:29221008-29221030 ATGGATACAGAATTTCTGTTTGG - Intergenic
1065884449 10:30064624-30064646 ATGGGTACAAAGTTTCATTTAGG - Intronic
1066110561 10:32192585-32192607 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1066252999 10:33652336-33652358 ATGAGTACAGAGTTTCAGCTTGG - Intergenic
1066456826 10:35579536-35579558 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1066534703 10:36379033-36379055 ATGAATATACAGTTTCAGGAAGG - Intergenic
1066611714 10:37255599-37255621 ATGACTACAGAGTTTCAGTTTGG - Intronic
1066763440 10:38780590-38780612 ATGGATACAAAATTACAGCTAGG + Intergenic
1066958374 10:42195051-42195073 ATGGATACAAAATTACAGCTAGG - Intergenic
1067237571 10:44464189-44464211 ATGGAGACAGAGTTTCTGCTGGG - Intergenic
1067407408 10:46035675-46035697 ATGGATATAGAGTTTCAGATTGG + Intronic
1067546770 10:47197456-47197478 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1067781184 10:49208665-49208687 ATTTATACACAGTGTCACCTTGG + Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1067935300 10:50606339-50606361 ATGGGCATAGAGTTTCAGCTTGG + Intronic
1068984317 10:63093050-63093072 GTGGATACAAAATTTCAGTTAGG - Intergenic
1069244473 10:66186014-66186036 ATGGATACAAAGTTATAGTTAGG + Intronic
1069676487 10:70252400-70252422 ATAGATACAGAGTTGCAGTTTGG + Exonic
1069712376 10:70498043-70498065 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1070051006 10:72889791-72889813 ATGCATACAGAGTGTCAGTTTGG + Intergenic
1070062627 10:72999614-72999636 ATGAGTACAGAGTTTCAGTTGGG - Intergenic
1070228228 10:74534624-74534646 ATGCATGTAAAGTTTCAGCTTGG + Intronic
1070228387 10:74536621-74536643 ATGGGTACAGAGCTTCTGCTTGG - Intronic
1070320326 10:75350104-75350126 ATGGATTTACAGTTTCAGGAAGG + Intergenic
1070368732 10:75761559-75761581 ATGGATACAGAGTTTCTGTTTGG + Intronic
1070574061 10:77664100-77664122 ATGGGCACATAGTTTCAGTTTGG - Intergenic
1071483832 10:86084902-86084924 ATGGGTACAAAGTTGCAGTTTGG + Intronic
1071529761 10:86380171-86380193 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1071795109 10:88996477-88996499 AAGGATACAAAATTTCAGTTAGG + Intronic
1071913429 10:90262542-90262564 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1072154280 10:92709802-92709824 ATGGATACAGAGTTTTATTTTGG - Intergenic
1072201905 10:93167750-93167772 ATTGGTACAGAGTTTCAGTTGGG + Intergenic
1072497632 10:95977945-95977967 ATGTGTACAGAGTTTCAGTTTGG + Intronic
1072584385 10:96768447-96768469 ATGGGTACCGGGTTTCAGCTTGG + Intergenic
1072724586 10:97804363-97804385 ATGGGTACAGAGTTTCCGTTTGG - Intergenic
1073144225 10:101269371-101269393 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1073222303 10:101885647-101885669 ATGGATATAGAGTTTCAGTATGG + Intronic
1073562480 10:104508780-104508802 ATGGGTACACAGTTTACACTTGG - Intergenic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073707130 10:105997595-105997617 AAGGACACAAAGTTTCAGTTGGG - Intergenic
1074075729 10:110122547-110122569 AAGGATACAAAATTTCAGTTAGG - Intronic
1074497965 10:113996514-113996536 ATGGATTCACCGTTTCACATAGG + Intergenic
1074712436 10:116188488-116188510 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1074955771 10:118387740-118387762 ATGGATACAGAATTTCTGTTTGG - Intergenic
1075071534 10:119323172-119323194 ATGGGTTCAGAGTTTCAGTTTGG + Intronic
1075327363 10:121544694-121544716 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1075346312 10:121684349-121684371 ATGGATACAGACTTTCCGTTTGG - Intergenic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1075803377 10:125167214-125167236 ATTGGTACAGAGTTTCAGTTTGG + Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1077182078 11:1221254-1221276 ATGGGGACAGGGTTTCAGCTTGG - Intergenic
1077668875 11:4139123-4139145 ATTGATACAGAGTTTCTGTTTGG - Intergenic
1077979932 11:7289339-7289361 ATAGGTACAGAGTTTCAGCATGG + Intronic
1078174266 11:8957616-8957638 TTGGAAACAAAGTTACAGCTTGG + Intronic
1078612751 11:12835866-12835888 ACGGGTACAAAGTTTCAGTTAGG + Intronic
1079009966 11:16819832-16819854 AAGGATGCAAAGTTTCAGTTAGG + Intronic
1079982717 11:27168249-27168271 ATGGGTACAAAGTTTAAGTTAGG - Intergenic
1080136980 11:28866543-28866565 ATGGACTCACAGTTTCACATGGG + Intergenic
1080375288 11:31702409-31702431 ATGGATACAGAGTTTCAATTTGG + Intronic
1080688000 11:34531573-34531595 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1080731515 11:34959920-34959942 ATAGATACAGAGTTTCAATTTGG + Intronic
1080788419 11:35497448-35497470 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1080882777 11:36338370-36338392 ATGGAAACAAAATTACAGCTTGG - Intronic
1080960082 11:37147817-37147839 ATGGCTACAGAGTTTCAGTTTGG - Intergenic
1081187096 11:40057061-40057083 AGGGATACAAAGTTTCAGTTAGG + Intergenic
1081344217 11:41962418-41962440 AAGGATACAAAATTTCAGTTAGG - Intergenic
1081624197 11:44637664-44637686 ATGGGTACAAAGTTACAGTTAGG + Intergenic
1082229528 11:49746093-49746115 ATGGATTCACAGTTGCACGTGGG + Intergenic
1082755477 11:57071577-57071599 ATGGATACAAACTTACAGTTAGG + Intergenic
1082820296 11:57540392-57540414 AGAGATATACAGTTTCAGCCAGG - Intergenic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1082902638 11:58272171-58272193 GTGGAGACACAGTTTTAGTTTGG - Intergenic
1083327971 11:61883170-61883192 ATGGGGACAGAGTTTCAGTTGGG - Intronic
1083844857 11:65325482-65325504 ATGGAGACACAGCTTCCGTTTGG - Intergenic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084582246 11:70031450-70031472 AAGGATACAAAGTTTCAGATAGG - Intergenic
1084677447 11:70644287-70644309 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1084724639 11:70933391-70933413 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1084763010 11:71285942-71285964 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1084987395 11:72888003-72888025 ATGGATACACAGTAGTAGCAAGG + Intronic
1084997414 11:72994952-72994974 ATGGATACAGAGTTTCTTTTTGG - Intronic
1085059517 11:73431897-73431919 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1085240939 11:75054776-75054798 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1085437015 11:76515018-76515040 ATGGATACATAGTTTGAATTTGG - Intronic
1085564971 11:77505525-77505547 ATGGATATGGAGTTTCAGTTTGG - Intergenic
1085738469 11:79059709-79059731 ATGGGTACAGATTTTCAGTTTGG - Intronic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1086130059 11:83392255-83392277 ATGGATAGAGAGTTTCAGTTTGG - Intergenic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086337817 11:85816508-85816530 ATGGATACAGAGTCTCAGTGTGG + Intergenic
1086720483 11:90115138-90115160 ATGGATACAAAATTACAGCTAGG + Intergenic
1086753317 11:90527149-90527171 ATGGGTATATAGTTTCAGGTTGG + Intergenic
1086975284 11:93125197-93125219 ATGGGTACAGATTTTCAGTTTGG - Intergenic
1086975694 11:93130251-93130273 AAGGATACAAAGTTACAGATAGG - Intergenic
1087427081 11:98003081-98003103 GTGGGTACACAGTTTCAATTAGG + Intergenic
1087785702 11:102352019-102352041 ATGGGTAGACAGTTTCAGTTTGG - Intronic
1087803952 11:102535285-102535307 ATGGATACAGAGTTTCTCTTTGG - Intergenic
1088215880 11:107508626-107508648 ATTGATACAGAGTTTCAGTTTGG - Intronic
1088377262 11:109155517-109155539 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1088430275 11:109751104-109751126 ATGGGTACAAAATTTCAGTTTGG + Intergenic
1088434285 11:109793892-109793914 ATGGGTACAGAGTTTCGGTTTGG + Intergenic
1088497851 11:110449957-110449979 AAGGCTACAAAGTTTCAGTTAGG - Intronic
1088512385 11:110591036-110591058 AAGGATACAAAATTTCAGTTAGG + Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1088708917 11:112488818-112488840 ATTGATCCACAGTTCCAGATTGG + Intergenic
1088751828 11:112848623-112848645 ATGGGTACACAGTTCCTGTTTGG + Intergenic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1088898651 11:114097330-114097352 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1089008849 11:115115871-115115893 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1089277569 11:117348755-117348777 ATGGCTATAGAGTTTCAGTTTGG - Intronic
1089776526 11:120840850-120840872 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1090285925 11:125499137-125499159 ATGGATACAGAGTTTCTGTTTGG - Exonic
1090365843 11:126204800-126204822 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1090936766 11:131349924-131349946 AAGGATAAAAAATTTCAGCTTGG + Intergenic
1091107026 11:132932179-132932201 ATGGATTCTGAGTTTCAGTTTGG + Intronic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091442531 12:522538-522560 ATGGGTACGGAGTTTCAGTTCGG + Intronic
1091568980 12:1668033-1668055 ATGGGGACAGAGTTTCAGTTGGG + Intergenic
1091608646 12:1982337-1982359 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1091939287 12:4461927-4461949 ATGGGTATAAAGTTACAGCTAGG - Intergenic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092156240 12:6283450-6283472 ATGGGTTCAGACTTTCAGCTTGG + Intergenic
1092232751 12:6785809-6785831 ATGGGTACAGAGTTTCATTTGGG + Intergenic
1092410694 12:8250844-8250866 ATGGATACAGGGTTTCTTCTGGG - Intergenic
1092729125 12:11511802-11511824 ATGGGTACAGAATTTCAGGTTGG + Intergenic
1092749018 12:11701248-11701270 CTGGGGACAGAGTTTCAGCTGGG - Intronic
1092814237 12:12299233-12299255 ATGGATATGGAGTTTCAGTTTGG - Intergenic
1093035543 12:14329116-14329138 AAGGATATACAGTTTCATTTAGG + Intergenic
1093156274 12:15689742-15689764 ATGGGTACACAGTTTCAGTTAGG - Intronic
1093466128 12:19451512-19451534 AAGGGAACACAGTTTCAGCCTGG - Intronic
1094311210 12:29086131-29086153 ATGGATACAAAGTTTTGGTTTGG + Intergenic
1094462790 12:30715538-30715560 ATGATTACAAAGTTTCAGTTGGG + Intronic
1094666177 12:32523412-32523434 ATGAGTACAGAGTTTCAGTTGGG - Intronic
1094812998 12:34160000-34160022 GTGGATACAGAGTTTCACTTTGG + Intergenic
1095265567 12:40153267-40153289 ATGGGTATAGAGTTTCAGTTTGG - Intergenic
1095394750 12:41749210-41749232 ATGACTACAAAGTTACAGCTAGG - Intergenic
1095406970 12:41877417-41877439 ACGGATACAAAATTTCAGTTAGG + Intergenic
1095423991 12:42055697-42055719 ATGGGTATAGAGTTTCAGTTTGG - Intergenic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096052302 12:48621305-48621327 AAGGGTACAAAGTTTCAGGTAGG + Intergenic
1096166974 12:49434408-49434430 ATGGATACAAAGTTTTTGTTGGG - Intronic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097498829 12:60377206-60377228 ATGGACTCACAGTTTCATGTGGG - Intergenic
1097593950 12:61604455-61604477 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1097763651 12:63498246-63498268 AAGGATACAAAATTTGAGCTAGG - Intergenic
1097774090 12:63625783-63625805 ATGTATACAAAGTTTCAGTTAGG + Intronic
1097781525 12:63711738-63711760 ATGGATACAGAGTTTCTGTTTGG + Intergenic
1097877528 12:64657301-64657323 GGCGATACAGAGTTTCAGCTGGG + Intronic
1098457289 12:70689062-70689084 AAGGATACAAAATTTCAGTTAGG + Intronic
1098606310 12:72395151-72395173 AAGGATACAAAATTTCAGTTAGG - Intronic
1099134350 12:78877165-78877187 ATGGATTCACAGTTCCACATGGG + Intronic
1099256135 12:80315110-80315132 AAGGGCACAAAGTTTCAGCTAGG + Intronic
1099373700 12:81869752-81869774 ATGGATATTCAGTTTCAGTGGGG + Intergenic
1099551481 12:84050070-84050092 AAGGATACACAGTTTTAGTTAGG - Intergenic
1099623127 12:85029540-85029562 AAGGATACAAAATTACAGCTAGG - Intronic
1100454992 12:94742989-94743011 ATGGGTACAGAATTTCAGTTTGG - Intergenic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1101167999 12:102059074-102059096 AAGGATACAAAATTTCAGTTAGG + Intronic
1101208916 12:102516629-102516651 ATGAATTCAGAGTTTTAGCTTGG + Intergenic
1101210743 12:102533204-102533226 ATGGATATGGAGTTTCAGTTTGG + Intergenic
1101293007 12:103390417-103390439 ATGGATGCAGAGTTTCTGTTTGG - Intronic
1101708918 12:107247033-107247055 ATAGGAACAGAGTTTCAGCTTGG + Intergenic
1101887575 12:108679515-108679537 AAGCATACACAGCTTCAGCGTGG - Intronic
1102087152 12:110151766-110151788 AAGGATACAAAATTTCAGTTGGG - Intronic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102787783 12:115618519-115618541 ATGGATACAGAGTTTCAATTTGG + Intergenic
1103030901 12:117611991-117612013 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1103168559 12:118792823-118792845 ATGGGTACACAATTTCAGTTAGG - Intergenic
1103257965 12:119559253-119559275 ATGGGTACAGAGTTTCTGCAAGG - Intergenic
1103292283 12:119856290-119856312 ATGGATAGAGAGTTTCTGTTTGG + Intronic
1103424620 12:120822120-120822142 ATGCATACAGAGTTTCTGTTTGG + Intronic
1103501892 12:121409477-121409499 CTGCCTACACTGTTTCAGCTGGG - Intronic
1103962804 12:124619870-124619892 ATGGAGACAGAGTTTCAGTTTGG + Intergenic
1104335800 12:127893827-127893849 AAGGATACAAAATTTCAGTTAGG - Intergenic
1104412861 12:128573727-128573749 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1104509036 12:129359287-129359309 ATGGTTACAGAGTTTCTGTTTGG + Intronic
1104634560 12:130429674-130429696 ATGCATACACATCTTCATCTGGG - Intronic
1104648697 12:130515334-130515356 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1105226501 13:18439473-18439495 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1105688215 13:22807458-22807480 AAGGATACAAAATTTCAGTTAGG + Intergenic
1105776576 13:23667687-23667709 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1105778933 13:23689691-23689713 ATGGATACTGAGTTTCTGTTGGG + Intergenic
1105848643 13:24315171-24315193 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1105952276 13:25240523-25240545 ATGGGTACACAGTTTTTGTTTGG + Intergenic
1105986080 13:25568634-25568656 ATGGGTATAGAGTTTCTGCTGGG + Intronic
1106065890 13:26348662-26348684 ATGGATTCAGAGTTTCTGTTTGG + Intronic
1106200234 13:27530229-27530251 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
1106331343 13:28742443-28742465 ATGGGTACAGAGTTTCAGTGTGG - Intergenic
1106357678 13:28999726-28999748 ATGGGTACAAAGTTACAGTTAGG - Intronic
1106397149 13:29392183-29392205 ATAGGTACAAAGTTTCAGTTTGG - Intronic
1106464725 13:30002939-30002961 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1106474139 13:30082813-30082835 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1106520653 13:30494757-30494779 ATGGATACAGAGTTTTAATTGGG - Intronic
1107241864 13:38245015-38245037 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
1107351123 13:39515873-39515895 ATGGAAATACAGTTTCACCAGGG + Intronic
1107593566 13:41936634-41936656 AAGGATACAAAATTTCAGCTAGG + Intronic
1107598857 13:41992091-41992113 ATGGATACAGAGTTTCTGCCTGG - Intergenic
1107664237 13:42672686-42672708 ATGGGTACAGAGTTTCTGTTGGG + Intergenic
1108032887 13:46255299-46255321 ATGGATATAGAGTTTCTGTTTGG + Intronic
1108175596 13:47789604-47789626 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1108349198 13:49575092-49575114 ATGGGTACAGAGTTTCACTTTGG + Intronic
1108431974 13:50362420-50362442 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1108560919 13:51643204-51643226 ATGGATACAGAATTTCCGCTTGG - Intronic
1108617396 13:52147633-52147655 ATGGGTACAGAGTTTCTGGTTGG + Intronic
1109290566 13:60470003-60470025 ATGGGTACAGAGTTTAAGTTTGG - Intronic
1110000471 13:70192589-70192611 ACGGGTACACAGTTCCAGATAGG - Intergenic
1110088886 13:71419249-71419271 ATGGACTCACAGTTTCACATGGG - Intergenic
1110338505 13:74361609-74361631 CTTGCTACACAGTTTCAGCTTGG - Intergenic
1110781336 13:79469051-79469073 ATGGGTACACAGTTTCAGTTTGG + Intergenic
1110992165 13:82055899-82055921 ATGGGTACAGAATTTCAGCTGGG + Intergenic
1111100657 13:83580868-83580890 TTGGATACAGAGTTTCAGTAGGG - Intergenic
1111194147 13:84850678-84850700 ATGGGTACAGAGTTTCAATTTGG - Intergenic
1111832816 13:93351470-93351492 AAGGATACAAAATTACAGCTAGG + Intronic
1111859830 13:93688792-93688814 ATAGATACACAGTTTCAGTTTGG + Intronic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112025655 13:95408644-95408666 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1112059255 13:95721019-95721041 ATGGATGCAGAGTTTCAGTTTGG - Intronic
1112312556 13:98332190-98332212 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1112346414 13:98593711-98593733 ATGGGCACAAAGTTTCAGTTTGG - Intergenic
1112370464 13:98788732-98788754 ATGGGTGCAGAGTTTCAGTTGGG - Intergenic
1112500475 13:99939336-99939358 ATGGACTCAGAGTTTCAGTTTGG - Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1112648698 13:101366880-101366902 AAGGGTACAAAGTTTCAGCTAGG - Intronic
1112714311 13:102166051-102166073 ATGGATGCAGAGTTTCTGGTTGG - Intronic
1112932428 13:104758560-104758582 ATGGCAACAGAGTTTCAGTTAGG + Intergenic
1112950047 13:104983084-104983106 TTGAATAAACAGTTTCATCTGGG + Intergenic
1114010954 14:18367976-18367998 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1114324288 14:21573375-21573397 AAAGGTACAAAGTTTCAGCTGGG + Intergenic
1114437547 14:22719956-22719978 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1114555520 14:23559986-23560008 GTGGGAACACAGTTCCAGCTCGG - Exonic
1114807938 14:25859323-25859345 ATGGGTACAGAGTTTTAACTGGG - Intergenic
1115280123 14:31652321-31652343 AAGGACACAAAGTTTCAGTTAGG + Intronic
1115307655 14:31948968-31948990 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1115632316 14:35257320-35257342 ACGGATACAGAGTTTCAGTTTGG - Intronic
1115667344 14:35566031-35566053 ATGGTTACACAGAATCTGCTTGG + Intronic
1115708786 14:36027110-36027132 ATGGATACAGTGTTTTAGTTTGG + Intergenic
1115779451 14:36753095-36753117 ATGGGTTCAGAGTTTCAGTTTGG + Intronic
1115791502 14:36884092-36884114 AAGGGTACAAAGTTTCAGCAAGG - Intronic
1115898354 14:38116794-38116816 ATGGATAGAAAGTTTCAGTTTGG + Intergenic
1115959761 14:38822183-38822205 ATGGGTACAGAGTTTGAGATTGG - Intergenic
1116051021 14:39803270-39803292 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1116380081 14:44256305-44256327 ATAGGTACAAAGTTTCAGTTAGG + Intergenic
1117098769 14:52324055-52324077 ATGGGTACAGAGTTTCAATTTGG + Intronic
1117123015 14:52589256-52589278 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1117127963 14:52651896-52651918 ATGGGTACAAAGTTTCAGTTAGG - Intronic
1117279402 14:54223010-54223032 ATGGGTACAGAGTTTCAATTTGG + Intergenic
1117559892 14:56926625-56926647 ATGGATACAACATTTCAGTTGGG - Intergenic
1117612377 14:57498149-57498171 ATGGGTACAAAGTTACAGTTAGG - Intergenic
1117850893 14:59968300-59968322 ATGGGTACAGAGTTTCAGTCTGG + Intronic
1118079496 14:62342022-62342044 AAGGATGCAAAGTTTCAGTTAGG - Intergenic
1118287412 14:64488775-64488797 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1118561232 14:67085826-67085848 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1118575283 14:67236191-67236213 AAGGATACAAAATTTCAGTTAGG - Intergenic
1118601636 14:67474678-67474700 ATGGATACAAAGTTTCTGTTTGG - Intronic
1118728120 14:68645113-68645135 ATGGGTACAGAATTTCAGGTTGG - Intronic
1118733626 14:68686726-68686748 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1119037040 14:71239213-71239235 ACGGATACTGAGTTTCAGTTGGG + Intergenic
1119372228 14:74156752-74156774 ATGGATACAAAATTACAGCTAGG - Intronic
1119562559 14:75602699-75602721 ACGGGTACAGAGTTTCAGATTGG + Intronic
1120161582 14:81151357-81151379 AAGGGTACAAAGTTTCAGCTAGG - Intergenic
1120533978 14:85669579-85669601 ATAGTTACACAGTTTCAGTATGG - Intergenic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1122146714 14:99693945-99693967 ACTGATACACAGTTTCAGTTAGG - Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1202934751 14_KI270725v1_random:76831-76853 ATGGATACAAAATTACAGCTAGG + Intergenic
1123662848 15:22580213-22580235 ATGGGTACAGAGTTTCTGATCGG - Intergenic
1123706123 15:22952253-22952275 GTGGATACAGAGTTTCGGCTTGG + Intronic
1124047822 15:26166602-26166624 ATGTGTACAGAGTTTCAGTTTGG - Intergenic
1124057872 15:26259336-26259358 ATGGATACAAAGTTACAGTTAGG - Intergenic
1124261436 15:28195703-28195725 ATGGGTACAGAGTTTCTGATCGG + Intronic
1124316649 15:28674517-28674539 ATGGGTACAGAGTTTCTGATCGG - Intergenic
1124411515 15:29441342-29441364 CTGGATACAGAGTTTCAGTTGGG + Intronic
1124415420 15:29469602-29469624 ATGACTACAGAGTTTCAGCTTGG + Intronic
1124503379 15:30250403-30250425 AGGGATACACAATTTCAGTTAGG + Intergenic
1124740176 15:32288236-32288258 AGGGATACACAATTTCAGTTAGG - Intergenic
1124873674 15:33569365-33569387 ATAAATACAGAGTTTCAGTTTGG - Intronic
1124945311 15:34259964-34259986 CAGGATACAAAGTTTCAGTTAGG + Intronic
1125035856 15:35122625-35122647 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1125319313 15:38466644-38466666 ATGGGTACAGAGTTTCAGTGAGG + Intronic
1125396525 15:39254570-39254592 ACGGATACAAAGTTTCAGTTAGG + Exonic
1125553223 15:40563538-40563560 ATGGGTACACAGTTTCAGTTTGG + Intronic
1125785877 15:42317423-42317445 ATGATTACAGAGTTTCTGCTTGG + Intronic
1125871808 15:43108997-43109019 ATGGATACGGAGTTTCATTTTGG + Intronic
1125988471 15:44079974-44079996 ATGGATACAGAGTTTCAGTTTGG + Intronic
1126296398 15:47141503-47141525 ATGGATACAAAATTTCAGCTAGG + Intergenic
1126568115 15:50121362-50121384 ATGGGTACAGGGTTTCAGATTGG + Intronic
1126569144 15:50130936-50130958 ATTGACTCACAGTTTCAGCATGG + Intronic
1126581197 15:50243870-50243892 ATGGATACAGAGTTTCTGCTCGG + Intronic
1126984232 15:54284540-54284562 ATGAATACAGGGTTTGAGCTGGG + Intronic
1127219385 15:56861833-56861855 AAGGATACAAAATTTCAGTTAGG + Intronic
1127220584 15:56876305-56876327 ATTGGTACAGAGTTTCAGTTTGG + Intronic
1127312393 15:57764094-57764116 ATGGGTACATAGTTTCAGTTTGG - Intronic
1127447938 15:59084719-59084741 ATGGGTACAAAGCTTCAGCTGGG - Intronic
1127593962 15:60458982-60459004 ATGGGTACTCAGTTTCAGTTTGG + Intronic
1127664247 15:61129473-61129495 ATGGGTACAGGGTTTCTGCTCGG + Intronic
1127695829 15:61446279-61446301 ATGGATACAAAGTTTCAGTTTGG + Intergenic
1127952966 15:63827990-63828012 ATGGATACACAGTTTCTTTTGGG + Intronic
1128220627 15:65965946-65965968 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1128355606 15:66924329-66924351 ATGGGTACTGAGTTTCAGTTTGG - Intergenic
1128410595 15:67393075-67393097 ATGGGTACAGAGTTTCTTCTTGG - Intronic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128585426 15:68845327-68845349 ATGGGCACAAAGTTTCAGTTTGG - Intronic
1128636668 15:69306803-69306825 CTGGGTACAGAGTTTCATCTGGG - Intronic
1128842937 15:70864785-70864807 ATGGAATCTCAGTTTCAGTTTGG + Intronic
1129437869 15:75556818-75556840 ATGGGTACAGAGTTTTTGCTGGG - Intronic
1129952923 15:79607741-79607763 ATGGGCACAGAGTTTCTGCTTGG + Intergenic
1130084028 15:80762262-80762284 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
1130425422 15:83793216-83793238 AAGGATACAAAATTTCAGTTAGG + Intronic
1131079547 15:89523244-89523266 ATGCATACACAGTGCCAGGTGGG - Intergenic
1131081438 15:89539634-89539656 ATGGGTACTGAGTTTCAGTTTGG + Intergenic
1131459780 15:92609903-92609925 CTGGATACAGACTTTCAGGTTGG + Intergenic
1131587411 15:93710915-93710937 ATGGATACAGAGTCTCATCTTGG + Intergenic
1131661356 15:94521350-94521372 AGGGATACCCAGTCACAGCTGGG + Intergenic
1131906699 15:97150352-97150374 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1132093898 15:98967882-98967904 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1133220827 16:4318519-4318541 GTGGCTACCCAGTTGCAGCTGGG - Intronic
1133946389 16:10352479-10352501 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1133982418 16:10642872-10642894 AAGGATACAAAGTTACAGCGAGG + Intronic
1134081815 16:11329985-11330007 ATGGATACAGAGTTTCCTTTGGG - Intronic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135502007 16:23004180-23004202 ATGGGTATAGAGTTTCAGTTTGG + Intergenic
1135866735 16:26110001-26110023 ATGGGTACAAAGTTTCACTTAGG - Intronic
1136094108 16:27941974-27941996 ATGACTACAGAGTTTCAGTTTGG + Intronic
1136279487 16:29199640-29199662 GTGGGGACACAGTTTCAGTTTGG - Intergenic
1136858859 16:33683074-33683096 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1137259783 16:46816258-46816280 ATGGGTACACGGTTTCAGTTTGG + Intronic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137297186 16:47106327-47106349 ATGGGTATAGAGTTTCAGTTTGG + Intronic
1137689422 16:50411272-50411294 ATGGATACAGAGTTTCCGTTTGG - Intergenic
1137750164 16:50855494-50855516 ATGGAAATAGAGTTTCAGTTGGG - Intergenic
1137795987 16:51220522-51220544 ATGGGTACAGAGTTTTAGTTTGG - Intergenic
1137898833 16:52243323-52243345 GTGGATACACAGTGACAGCAGGG + Intergenic
1137912736 16:52394740-52394762 ATGGGTACAGAGTTTCCGTTTGG + Intergenic
1137967341 16:52949158-52949180 ATGGTTACAGAGTTTCAGAAGGG + Intergenic
1137980988 16:53069393-53069415 ATGGGGACAGAGTTTCAGCTTGG - Intronic
1138028032 16:53538388-53538410 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
1138144935 16:54600012-54600034 ATGGGTACAGAGTTTTTGCTGGG - Intergenic
1139289327 16:65843279-65843301 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1139296040 16:65901755-65901777 ATGGACACACAGTAGGAGCTGGG + Intergenic
1139567796 16:67790323-67790345 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140295915 16:73709652-73709674 AAGGATACAAAATTTCAGTTAGG + Intergenic
1140322139 16:73963287-73963309 ATGGAAATACAGTTCCTGCTTGG + Intergenic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1140689284 16:77466054-77466076 ATGGTTACAGAGTTTCCGTTTGG + Intergenic
1140991557 16:80217786-80217808 ATGGATAACCAGTTTTAACTTGG + Intergenic
1141135822 16:81464692-81464714 ATGGGTACAGAGTTTGTGCTGGG - Intronic
1203120433 16_KI270728v1_random:1531568-1531590 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1142870481 17:2816763-2816785 ATGTATACGAAGTTTCAGTTTGG - Intronic
1142938276 17:3357583-3357605 ATGGGTACAGAGTTTCAATTGGG + Intergenic
1143087277 17:4425572-4425594 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
1143088605 17:4435095-4435117 ATAGAGACAGAGTTTCGGCTGGG - Intronic
1143109370 17:4544817-4544839 CTGGATACGCAGCTTCTGCTCGG + Exonic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1143702726 17:8673413-8673435 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1143760995 17:9104231-9104253 ATGGGTACAGAGTTTCAATTTGG + Intronic
1144053688 17:11519517-11519539 TTGGGGACAGAGTTTCAGCTAGG + Intronic
1144281150 17:13728019-13728041 AAGGATACAAAATTTCAGTTAGG - Intergenic
1144336221 17:14271267-14271289 ATGGATACAGATTTTCTGGTTGG - Intergenic
1144392448 17:14807200-14807222 ATAGGTATAGAGTTTCAGCTTGG + Intergenic
1144821839 17:18080553-18080575 ATGGGTGCAGAGTTTCAGTTTGG - Intergenic
1145042138 17:19584910-19584932 AAGGATACAAAGTTACAGTTAGG - Intergenic
1145065854 17:19760776-19760798 ATGGACACAGAGTTTCAGTTTGG - Intergenic
1145120214 17:20252484-20252506 GTGGATACAGAGTTTCAGTCAGG - Intronic
1146045342 17:29500996-29501018 ATGGATGCAGAGTTTCTGTTTGG + Intronic
1146345158 17:32055465-32055487 ATAGATACAGAGTTTCAATTTGG - Intergenic
1146497870 17:33338947-33338969 ATGGATACAGAGTTTCAGTTTGG + Intronic
1146747894 17:35347937-35347959 AAGGATACAAGGTTTCAGTTAGG + Intergenic
1146819595 17:35974274-35974296 ATGGGTACAGAGTCTCAGGTTGG + Intergenic
1146933575 17:36795404-36795426 ATGGATACAAAGTTGCAGTTTGG - Intergenic
1146961350 17:36982813-36982835 AATGATACAGAGTTTCAGTTTGG - Intronic
1147027575 17:37601571-37601593 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1147197389 17:38776378-38776400 ATGGGTATAGAGTTTCAGCTGGG + Intronic
1147860450 17:43518716-43518738 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1148281358 17:46350193-46350215 ATGGATACAAAGTTTCTGTTGGG + Intronic
1148303586 17:46568128-46568150 ATGGATACAAAGTTTCTGTTGGG + Intronic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1148833210 17:50449878-50449900 ATGGGTACAGAATTTCAGTTGGG - Intronic
1149316974 17:55447789-55447811 ATGGGCACAGAGTTTCTGCTTGG - Intergenic
1149709874 17:58730902-58730924 ATGGGTACAGAGTTTCAGTATGG - Intronic
1150045596 17:61910264-61910286 ATGGATACAGAGTTTCTGTTTGG + Intronic
1150158475 17:62873883-62873905 AAGGATACAAAATTACAGCTAGG - Intergenic
1150188048 17:63206748-63206770 ATGGATACAGAATTTCAGTTGGG + Intronic
1150353217 17:64461731-64461753 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1150665838 17:67136810-67136832 ATGCATACAGAGTTTCAGTTTGG + Intronic
1150681519 17:67288394-67288416 ATGGGTACAGAGTTTCTGTTGGG + Intergenic
1151030114 17:70727693-70727715 ATGAATACCCAGGTTCAGCGAGG + Intergenic
1151217308 17:72586036-72586058 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
1151649951 17:75460935-75460957 ATGGTGACAGAGTTTCAGTTTGG - Intronic
1151796610 17:76350626-76350648 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1151847403 17:76666939-76666961 ATGGCTACAGAGTTTCAGTTGGG - Intergenic
1152364292 17:79846085-79846107 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1152388734 17:79990712-79990734 ATGGAGACAAAGCTTCAGTTTGG - Intronic
1152490256 17:80626915-80626937 ATGGAGACAGAGTTTCTGTTTGG - Intronic
1152931165 17:83110779-83110801 ATGGGGACAGAGTTTCGGCTCGG - Intergenic
1152956013 18:42654-42676 GTGGATACAGAGTTTCACTTTGG + Intergenic
1153182577 18:2451787-2451809 AATGATATAGAGTTTCAGCTGGG + Intergenic
1153209449 18:2744728-2744750 AAGGATACAAAATTTCAGTTAGG - Intronic
1153319785 18:3761203-3761225 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1153358598 18:4166902-4166924 TTGGATACAGAGTTTCAGTTTGG + Intronic
1153709380 18:7782555-7782577 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1153797668 18:8639937-8639959 CTGGGTGCAGAGTTTCAGCTGGG + Intergenic
1153883474 18:9440762-9440784 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1154192073 18:12238151-12238173 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1154192211 18:12239713-12239735 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1154313604 18:13286054-13286076 ATGGGTACACAGTTTTGGTTTGG - Intronic
1154526884 18:15300007-15300029 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1155118615 18:22795660-22795682 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1155531356 18:26770290-26770312 ATGGGTACAGAGTTTCACCTGGG - Intergenic
1156022280 18:32613559-32613581 ATGGCTACAGAGTTTCTGTTTGG - Intergenic
1156138227 18:34070986-34071008 ATGGGTACAAAGTTACAGTTAGG + Intronic
1156164497 18:34401977-34401999 AAGGATATACAGTTTCAACCAGG - Intergenic
1156178316 18:34573811-34573833 AAGGATACGCAATTTTAGCTAGG - Intronic
1156182491 18:34622035-34622057 AAGGATACAAAATTTCAGTTAGG + Intronic
1156323437 18:36050107-36050129 ATGGATACAAAGTTTCAGTTTGG + Intronic
1156329398 18:36105268-36105290 ATGGGTACAGAGTTTCAATTTGG + Intergenic
1156340267 18:36204194-36204216 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1157593479 18:48849984-48850006 ATGGGGACAGAGTTTCAGCTGGG - Intronic
1157606836 18:48931187-48931209 ATGGGAACAAAGTTTCAGCTAGG + Intronic
1157618067 18:48999257-48999279 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1157686075 18:49643917-49643939 ATGGAGGCAGAGTTTCAGTTTGG - Intergenic
1157693932 18:49705687-49705709 ATGGATACAGAACTTCAGTTTGG - Intergenic
1157784034 18:50466109-50466131 AAGGATTCACTGTCTCAGCTTGG + Intergenic
1157876309 18:51276944-51276966 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1158104259 18:53867555-53867577 AAGGATACAAAATTTCAGTTAGG - Intergenic
1158129572 18:54138161-54138183 ATGAATACTAAGTTTCAGTTGGG - Intergenic
1158170236 18:54590127-54590149 ATGAATACACAATTTCAGTTTGG - Intronic
1158425402 18:57335532-57335554 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1158433197 18:57410784-57410806 AAGGATACAAAATTTCAGTTAGG - Intergenic
1158578045 18:58656831-58656853 ATGGGTATAGAGTTTCAGTTGGG + Intergenic
1158664810 18:59422787-59422809 CTGGACTCACAGTTTCACCTTGG - Intergenic
1158672374 18:59488215-59488237 ACGGATACAGAGTTTCAGTTTGG + Intronic
1158683797 18:59594421-59594443 ATGGGTACAGAGTTTCCGTTGGG + Intronic
1158876254 18:61737207-61737229 GTGGGTTCAGAGTTTCAGCTGGG + Intergenic
1158895207 18:61906249-61906271 ATGAATACAGAGTTCCAGTTTGG - Intergenic
1158965401 18:62618029-62618051 ATGGATACACAGTTTCAGTTTGG + Intergenic
1159006148 18:63014521-63014543 ACGGATACAGAGTTTCAGTTTGG - Intergenic
1159617729 18:70600720-70600742 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1161128572 19:2574347-2574369 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161147051 19:2685207-2685229 ATGAGGACACAGTTTCAGTTTGG + Intronic
1161245711 19:3250594-3250616 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161276207 19:3419102-3419124 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161296167 19:3521403-3521425 ATGGCGACAGAGTTTCAGTTTGG + Intronic
1161371747 19:3916013-3916035 ATGGAGACAGAGTTTCAGTTTGG - Intronic
1161554718 19:4934431-4934453 ATGGAGTCAGAGTTTCAGTTTGG - Intronic
1161634905 19:5381852-5381874 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161920610 19:7262872-7262894 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161928959 19:7323371-7323393 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1161931465 19:7343364-7343386 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161987840 19:7667142-7667164 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161994995 19:7706673-7706695 ATGGGGACACGGTTTCAGTTTGG - Intergenic
1162124597 19:8492631-8492653 ATGGGTACAAAGTTACAGTTAGG + Intronic
1162133037 19:8538877-8538899 CTGGGGACACAGTTTCAGTTTGG + Intronic
1162330164 19:10023221-10023243 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162862994 19:13522104-13522126 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1162872353 19:13595837-13595859 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1163165944 19:15498342-15498364 ACGGGGACAGAGTTTCAGCTGGG - Intronic
1163810295 19:19427160-19427182 ATGGGGATAGAGTTTCAGCTGGG + Intronic
1164440650 19:28275944-28275966 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1165500971 19:36189047-36189069 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1165598618 19:37033325-37033347 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1165946928 19:39449187-39449209 ATAGATACACAGTTACTGCAGGG + Intronic
1166017312 19:39992295-39992317 AAGGATATACAGTTTCAATTAGG - Intronic
1167174362 19:47855209-47855231 ATAGGTACAAAGTTTCAGTTTGG - Intergenic
1167190218 19:47982981-47983003 ATGGGTGCAGAGTTTCAGTTTGG + Intronic
1167719774 19:51170739-51170761 ATGAAGACACACTTTCGGCTGGG - Intergenic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
1168512371 19:56983061-56983083 ATGGATGCAGAGTTTCAGTTGGG + Intergenic
925457934 2:4033267-4033289 ATGGATACACGATTTTAGCAAGG - Intergenic
925973851 2:9126953-9126975 ATGGATACAGAGTTTCTACATGG + Intergenic
926099866 2:10107822-10107844 ATGGGTCCAGAGTTTCAGTTTGG + Intergenic
926175529 2:10588349-10588371 ATGGGTACAGAGTTTCAGGTTGG - Intronic
926208583 2:10851683-10851705 ATGGACATAGAGTTTCAGTTTGG - Intronic
926609010 2:14926730-14926752 ATGGGTACAGGGTTTCAACTGGG - Intergenic
926722902 2:15975335-15975357 ATGGGTACAAAGTTTCAATTTGG + Intergenic
926940590 2:18132066-18132088 AGGGATACAAAGTTTCAATTAGG + Intronic
927325974 2:21805636-21805658 CTAGATACTCAGTTTAAGCTTGG - Intergenic
927750841 2:25669143-25669165 AGGGGTACAGAGTTTCAGTTGGG + Intronic
928052764 2:28017640-28017662 ATGCATACACAGTTTCTTTTTGG - Intronic
928163978 2:28955984-28956006 ATGGATACAGAGTTTCAGTGTGG - Intergenic
928232126 2:29507400-29507422 TTGGGTACACAGTTTCAGTTTGG + Intronic
928333532 2:30376140-30376162 ATGGGTACACAGTTTCTGTTGGG - Intergenic
928596059 2:32860242-32860264 AAGGATACAAAGTTTCAGTTAGG - Intergenic
928982691 2:37153269-37153291 ATGGGTACACACTTTCTGTTTGG - Intronic
929102077 2:38324906-38324928 ATGGGCACAGAGCTTCAGCTGGG + Intronic
929181123 2:39040448-39040470 ATGGATACAGAGTTTCAGTTTGG - Intronic
929196972 2:39194931-39194953 AAGGATACAGAGTTTCAGGCTGG - Intronic
929488214 2:42373712-42373734 ATGAGTACAGAGTTTCAGTTGGG - Intronic
929747666 2:44675788-44675810 ATGGTGACAGAGTTTCAGTTTGG - Intronic
929964832 2:46526501-46526523 ATGGATACAGAGTTTAAATTTGG - Intronic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
931019159 2:58023096-58023118 ATGGCTACAGAGTTTCAGTCTGG - Intronic
931752872 2:65346473-65346495 ATAGGTACAGAGTTTCAGTTTGG - Intronic
932188944 2:69722643-69722665 ATGGATACAGACTTTCTGTTGGG + Intronic
932346100 2:70996123-70996145 ATGGATACAGGGTTTCAGTTTGG + Intergenic
932399999 2:71473830-71473852 ATGGGTATAGAGTTTCAGCTGGG - Intronic
932586156 2:73030608-73030630 ATGGGTAGAGAGTTTCAGGTTGG - Intronic
932746738 2:74340062-74340084 ATGGGTATAAAGTTTCAGTTGGG + Intronic
932804923 2:74775194-74775216 ATGGGTACAAAGTTTCTGTTTGG + Intergenic
933761851 2:85678016-85678038 ATGGGCACAGAGTTTCTGCTTGG - Intergenic
934306495 2:91827466-91827488 ATGGATACAAAATTACAGCTAGG - Intergenic
934326761 2:92025276-92025298 ATGGATACAAAATTACAGCTAGG + Intergenic
934465133 2:94255824-94255846 ATGGATACAAAATTACAGCTAGG + Intergenic
934705189 2:96472374-96472396 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
935073092 2:99713106-99713128 ATGGGCACAGAGTTTCAGTTTGG + Intronic
935186807 2:100742032-100742054 ATGGGTATAAAGTTTCAGTTAGG + Intergenic
935479574 2:103569216-103569238 ATGGTTACAGAGTTTCTGTTTGG + Intergenic
935716766 2:105946076-105946098 ATGGAGACTGAGTTTCAGTTTGG + Intergenic
935985450 2:108668323-108668345 ATGGGTACAAAGTTACAGTTAGG - Intronic
936001000 2:108830281-108830303 ATGGATACAGAGTTTCATTTTGG + Intronic
936086217 2:109471278-109471300 ATTGACTCTCAGTTTCAGCTGGG + Intronic
936257687 2:110930860-110930882 ATGGACACACAGTTTCACAAGGG - Intronic
936621642 2:114105567-114105589 AAGGATATAAAGTTTCAGTTAGG - Intergenic
936696700 2:114958413-114958435 ACGGGTACAAAGTTTCAGCTGGG + Intronic
936709278 2:115112732-115112754 AAGGATACAAAATTTCAGTTAGG + Intronic
936848357 2:116865955-116865977 AGGGATAGACAGTCTGAGCTGGG + Intergenic
937030554 2:118735745-118735767 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
938185004 2:129223652-129223674 ATGGGTGTACAGTTTCACCTGGG + Intergenic
938525981 2:132131364-132131386 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
939349769 2:141020574-141020596 AAGGATGAACAGTTTCAGCAGGG + Intronic
939869268 2:147508784-147508806 AAGAATACACAGTTTCAGGCTGG + Intergenic
940197321 2:151109691-151109713 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940325245 2:152418419-152418441 ATGGGTAGAGAGTTTCAGTTTGG - Intronic
940421483 2:153483902-153483924 ATGGGTACAGAGTTTGAGTTTGG + Intergenic
940641967 2:156354321-156354343 ACTGATACAGAGTTTCAGTTTGG - Intergenic
940789166 2:158013652-158013674 ATGGATACAGAGTTCCTGCGTGG + Intronic
940887381 2:159001391-159001413 ATGAGTACAGAGTTTCAGTTGGG + Intronic
940937265 2:159510487-159510509 ATGGTTACAGAGTTTCTGTTTGG + Intronic
940977665 2:159964257-159964279 ATGGTTACAGAGTTTCTGTTTGG + Intronic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941011343 2:160303231-160303253 AAGAAGAGACAGTTTCAGCTAGG - Intronic
941060456 2:160841696-160841718 ATGGGTATAGAGTTCCAGCTGGG + Intergenic
941092210 2:161190825-161190847 ATGGATACAGAGTTTCAGTTAGG + Intronic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941607318 2:167615426-167615448 AAGGATACAAAATTTCAGTTAGG + Intergenic
941826974 2:169909531-169909553 AAGGGTACAAAGTTTTAGCTAGG + Intronic
942364174 2:175205415-175205437 ATGGATACAGAATTTCAGTTTGG - Intergenic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
942714155 2:178871883-178871905 ATGGGTACAGAGTTTCTGTTTGG - Intronic
942756984 2:179352793-179352815 AAGGGTACAAAGTTTCAGCTGGG - Intergenic
943000819 2:182326582-182326604 ATGGATACAGAGTTTCAGTTTGG + Intronic
943272448 2:185824106-185824128 ATTGGTATACAGTTTCAGTTGGG + Intronic
943613581 2:190065319-190065341 ATAGATACAGAGTTTCAGTCTGG + Intronic
944210729 2:197203976-197203998 ATGGATACAGAGTTTCATTTGGG + Intronic
944315503 2:198281194-198281216 ATGGTTACAGAGTTTCAGTTTGG - Intronic
944335023 2:198522363-198522385 TTGGTTAATCAGTTTCAGCTGGG + Intronic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
944772446 2:202928082-202928104 ATGGTTACAAAGGTACAGCTAGG - Intronic
944894228 2:204147606-204147628 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
945108367 2:206338800-206338822 ATGGGTACAAATTTTCAGTTAGG - Intergenic
946657561 2:221964700-221964722 ATTGTCACACAGTTTCATCTTGG + Intergenic
946902772 2:224388588-224388610 ATGGGTACAGAGTTTCTGTTTGG + Intronic
946993691 2:225365991-225366013 ATAGGTACAGAGTTTCAGCTTGG - Intergenic
947265984 2:228282065-228282087 ATGGGTATACAGTTTTAGTTTGG + Intergenic
947388198 2:229613755-229613777 AAGGAAAGACAGTTTGAGCTGGG + Intronic
947891757 2:233629079-233629101 ATGGGTCCAAAGTTTCAGTTTGG - Intronic
948105261 2:235408342-235408364 ATGGATACAGATTTTCAATTTGG + Intergenic
948706308 2:239795571-239795593 ATGGGGACAGAGTTTCAGTTTGG - Intronic
948708602 2:239811187-239811209 ATGAAAGCACAGTTCCAGCTTGG + Intergenic
1168988025 20:2067446-2067468 ACGGGTACAGAGTTTCAGGTTGG + Intergenic
1169098524 20:2925152-2925174 ATGGATATGGAGTTTCAGTTTGG - Intronic
1169107384 20:3008490-3008512 GTGGGTACAGAGTTTCATCTGGG + Intronic
1169387204 20:5160676-5160698 ATGGGTACAGAGTTTCATTTGGG - Intronic
1169895030 20:10494874-10494896 AGGGGTACAAAGTTTCAGTTAGG + Intronic
1170269385 20:14507145-14507167 ATGGGTACAGGGTTTCAGTTTGG + Intronic
1170462590 20:16591273-16591295 ATGGGTACTGATTTTCAGCTTGG - Intergenic
1170611136 20:17914537-17914559 ATGGGAATAGAGTTTCAGCTTGG + Intergenic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1170874879 20:20240996-20241018 ACGGATCCACAGAGTCAGCTAGG - Intronic
1171289469 20:23973414-23973436 ATGGACTCACAGTTTCTACTTGG - Intergenic
1172070207 20:32251196-32251218 ATGGGTCCAGAGTTTCAGTTTGG - Intergenic
1172321242 20:33996749-33996771 ATGGGTACAGAATTTCAGTTGGG - Intronic
1172405305 20:34684065-34684087 ATAGGTACGGAGTTTCAGCTGGG + Intergenic
1172412587 20:34736464-34736486 ATGCATTCATAGTGTCAGCTAGG - Intronic
1172422888 20:34832355-34832377 ATGAATACAAAGTTTCAGTTGGG + Intergenic
1172501283 20:35429571-35429593 ATGATTTCACAGTTTCAGATGGG - Intergenic
1172554648 20:35830230-35830252 ATAGATACAGGGTTTCAGTTTGG - Intronic
1172638548 20:36426591-36426613 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1172651595 20:36506783-36506805 ATGGGTACAGAATTTCAGCTGGG - Intronic
1172724970 20:37032426-37032448 ATGGATACAGAATTTCAGAATGG + Intronic
1173030565 20:39355196-39355218 AAGGGTACAAAGTTTCAGTTTGG + Intergenic
1173405857 20:42764098-42764120 ATTGATAGACAGTTTCAAGTGGG + Intronic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1174894351 20:54433121-54433143 AGGGATACAAAGTTTCAGTTAGG - Intergenic
1175705993 20:61177154-61177176 ATGGATACAGAGTTTATGCTTGG + Intergenic
1176378702 21:6100945-6100967 ATGGGTTCAGAGTTTCAGTTTGG - Intergenic
1176596165 21:8699044-8699066 ATGGATACAAAATTACAGCTAGG + Intergenic
1176770552 21:13068498-13068520 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1177423197 21:20889168-20889190 ATAGAAACACAGTTTCAATTCGG + Intergenic
1177474625 21:21603478-21603500 ACGGATACAGTGTTTCAGTTGGG + Intergenic
1177705335 21:24696788-24696810 ATGGGTACAGAGTTTCAATTGGG + Intergenic
1179039949 21:37793798-37793820 ATGGACACACAGCTTCTGCAAGG + Intronic
1179428125 21:41297942-41297964 ATGGATACAAAATTTCAGTTAGG + Intergenic
1179462203 21:41544089-41544111 AGAAATACACAGTTTCAGCCAGG + Intergenic
1179744773 21:43437292-43437314 ATGGGTTCAGAGTTTCAGTTTGG + Intergenic
1179815433 21:43903276-43903298 ATGGAGACAGTGTTTCTGCTTGG + Intronic
1179948170 21:44694438-44694460 ATGGGGACAGAGTTTCAGTTCGG + Intronic
1180231284 21:46428257-46428279 ATGGGTGCACAGTATCTGCTGGG - Intronic
1180279076 22:10676492-10676514 ATGGATACAAAATTACAGCTAGG + Intergenic
1180435448 22:15298780-15298802 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1180517644 22:16162591-16162613 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1180586287 22:16895023-16895045 ATGGATACAAAATTACAGCTAGG + Intergenic
1181046887 22:20219132-20219154 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1181433523 22:22897013-22897035 ATAGATGCAGAGTTTGAGCTTGG - Intergenic
1181479476 22:23189283-23189305 ATGGATATGAAGTTTCAGTTTGG - Intronic
1181623815 22:24108577-24108599 ATGGATCATCAGTATCAGCTGGG - Intronic
1181784447 22:25216742-25216764 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1181975398 22:26725479-26725501 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1182233707 22:28859202-28859224 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1182408844 22:30163913-30163935 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1182672008 22:32004304-32004326 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1182805316 22:33064786-33064808 ATAGATACACATTTCAAGCTGGG - Intergenic
1183473635 22:38023589-38023611 ATGGGCATACAGTTTCAGTTCGG - Intronic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184429936 22:44436719-44436741 ATGAAGACAGAGTTTCAGTTTGG - Intergenic
1184518251 22:44976425-44976447 ATGGGTACAAAGTTACAGTTAGG - Intronic
1184823268 22:46928977-46928999 ATGGGTACAGAGTTTCTTCTGGG + Intronic
949095309 3:78656-78678 ATGCAAACACAGTCTGAGCTTGG + Intergenic
949324606 3:2849283-2849305 AGGGATACAGAGTTTCAGTTTGG + Intronic
949385318 3:3495424-3495446 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
949857433 3:8474760-8474782 ATGGGTACAGAGTTTCAGTCTGG + Intergenic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
950036475 3:9889651-9889673 ATGGGTACAGAGCTTCAGTTCGG - Intergenic
950527161 3:13531150-13531172 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
950645157 3:14372720-14372742 ATGGAGGGACAGTGTCAGCTAGG - Intergenic
950732211 3:14970447-14970469 ATGGATACCGAGTTTCAGTCTGG - Intronic
950745790 3:15087574-15087596 AAGGATACAAAATTTCAGCCGGG - Intronic
950881260 3:16324389-16324411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
951163666 3:19458703-19458725 AAGGATACAGAGTTTAAGCTAGG - Intronic
951210201 3:19966160-19966182 GTGGGTGCAGAGTTTCAGCTAGG - Intronic
951448389 3:22808661-22808683 ATAGGTACAGAGTTTCAGTTGGG + Intergenic
951649813 3:24938685-24938707 ATGGGTACACAGCTTCTGTTTGG - Intergenic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
951775531 3:26306238-26306260 ATGGGTACAAAGTTTCACATGGG + Intergenic
951824569 3:26853884-26853906 ATGAAAACACTATTTCAGCTGGG - Intergenic
952292907 3:32035913-32035935 ATGGATACAGAGTTTCAATTTGG - Intronic
952345300 3:32478288-32478310 ATGGATACAAAGTTACAGTTAGG + Intronic
952459573 3:33510247-33510269 ATGGGTACAGAGTTTCAGTCTGG + Intronic
952773775 3:37025181-37025203 ATGGGCACAGAGTTTCAGTTTGG + Intronic
953005589 3:38975848-38975870 ATGGATATAGAGTTTCAATTTGG + Intergenic
953231398 3:41068225-41068247 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
953695558 3:45155682-45155704 ATGGTTGCAGAGTTTCAGTTCGG - Intergenic
953724375 3:45384869-45384891 AGGGATACAGAGTTCCAGTTTGG - Intergenic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
953862752 3:46558954-46558976 AAGGGTACAAAGTTTCAGATAGG + Intronic
954175259 3:48839983-48840005 ATAGGTACAGAGTTTCAGTTTGG - Intronic
954283919 3:49604334-49604356 ATGGGTACAGAGTTTCTGTTTGG - Intronic
954743494 3:52773330-52773352 ATGGGTGCAGAGTTTTAGCTGGG + Intergenic
955462194 3:59195431-59195453 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
955771424 3:62388512-62388534 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
955900126 3:63744625-63744647 ATGGGTATAGAGTTTCAGTTAGG + Intergenic
956027585 3:64999861-64999883 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
956121461 3:65970364-65970386 ATCGATAAAGAGTTTCAGTTTGG + Intronic
956443675 3:69305025-69305047 ATGTATAAAGAGTTCCAGCTTGG - Intronic
957055919 3:75442953-75442975 ATGGATACAGGGTTTCTTCTGGG - Intergenic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
957801221 3:85085173-85085195 AAGGTTACAAAGTTTCAGTTAGG - Intronic
958103533 3:89045066-89045088 ATAGATACCCAGTTTGAGATGGG - Intergenic
958774742 3:98468448-98468470 ATGGTTACAGAGTTTCAGTTTGG - Intergenic
959036823 3:101376224-101376246 ATAGATACAGAGTTTCAGTTTGG + Intronic
959037117 3:101380197-101380219 ATAGATACAGAGTTTCAGTTTGG + Intronic
959139882 3:102472935-102472957 ATGGACTCACAGTTTCACATGGG + Intronic
959624945 3:108439127-108439149 ATGCATACACTATGTCAGCTGGG + Intronic
959676624 3:109042949-109042971 AAGGATACACAATTTTAGTTAGG + Intronic
959915561 3:111813173-111813195 AAGGATACAAAGTTTCAGCTTGG + Intronic
960893516 3:122477304-122477326 AGGGATACAAAATTTCAGTTAGG + Intronic
960996107 3:123341503-123341525 ATGGGTATACCGTTTCAGCTTGG + Intronic
961021383 3:123510113-123510135 ATGGGTACAGAGTTTCTGTTTGG - Intronic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
962002647 3:131315227-131315249 AAGCATACACAGTTGCAGGTAGG - Intronic
962111865 3:132459448-132459470 ATGATTACAGAGTTTCAGTTTGG + Intronic
962182030 3:133216555-133216577 AAGGATACAAAGTTTCAGTTAGG - Intronic
963205835 3:142633250-142633272 ATGGGTATAGAGTTTCAGATTGG + Intronic
963208856 3:142666277-142666299 ATGGATATGGAGTTTCAGTTTGG - Intronic
963570767 3:146992608-146992630 ATGGGTAAAAAGTTTCAGTTTGG - Intergenic
963664304 3:148163209-148163231 AAGGATACAAAATTACAGCTAGG - Intergenic
963777973 3:149458876-149458898 ATGGGTATAGAATTTCAGCTTGG + Intergenic
964790226 3:160446991-160447013 ATGGGTACACAGTTTCAGTTTGG + Intronic
964827472 3:160844860-160844882 ATGGGTACAAAGCTTCTGCTTGG - Intronic
965205281 3:165713617-165713639 ATGGATCCACAGCCACAGCTGGG + Intergenic
965505370 3:169509465-169509487 TTGGGTACAGAGTTTCAGTTTGG - Intronic
965675323 3:171189042-171189064 ATAGGTACAAAGTTTCAGCTGGG - Intronic
966251875 3:177875161-177875183 ATGGATACACAGGTTCATGTTGG + Intergenic
966290962 3:178359242-178359264 AAGGGTACAAAGTTTCAGCTAGG + Intergenic
966412797 3:179660242-179660264 ATGGATACAGAGTTTCAGTTTGG - Intronic
966478553 3:180378666-180378688 ATGGTTATAGAGTTTCTGCTTGG - Intergenic
966531349 3:180984744-180984766 ATGGATTCTCAATTTCTGCTTGG + Intronic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
966890260 3:184402140-184402162 ATGGGTACAGAGTTTCTGTTTGG - Intronic
967052148 3:185794782-185794804 ATGGGAACAGAGTTTCAGTTTGG - Intronic
967663879 3:192148473-192148495 ATGAGTACAGAGTTTCAGTTGGG + Intronic
967906282 3:194503222-194503244 ATGGATACAGAGTTTCTTTTGGG + Intergenic
968215051 3:196882349-196882371 ATGGGTACAGAATTTCAGTTTGG - Intronic
968358331 3:198125582-198125604 GTGGATACAGAGTTTCACTTTGG - Intergenic
968732623 4:2276833-2276855 ATGGGGAAACAGTTTCAGTTTGG + Intronic
968819748 4:2841891-2841913 ATGGGTACAGAGTTTAAGCTTGG - Intergenic
968998723 4:3963262-3963284 ATGGATACAGGGTTTCTTCTGGG - Intergenic
969128535 4:4973293-4973315 ATGGAGAAAGAGTTTCAACTGGG - Intergenic
969136391 4:5032755-5032777 ATGGGGACAGAGTTTCAGCTTGG - Intergenic
969359557 4:6653915-6653937 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
969371845 4:6736541-6736563 ATGGGGACAGAGTTTCAGTTGGG - Intergenic
969372157 4:6739771-6739793 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
969755267 4:9145371-9145393 ATGGATACAGGGTTTCTTCTGGG + Intergenic
969815167 4:9681570-9681592 ATGGATACAGGGTTTCTTCTGGG + Intergenic
969918287 4:10511477-10511499 ATGGATACAGAGTTTCAGTTTGG - Intronic
970176421 4:13344103-13344125 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
970569681 4:17367602-17367624 ATGGGTACAAAGCTTCAGTTTGG + Intergenic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
971350277 4:25849555-25849577 ATGGGTCCAGAGTTTCAGTTTGG + Intronic
971368527 4:25996379-25996401 ATGGATACAGACTTTCAGCTGGG - Intergenic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
971985769 4:33821645-33821667 ATGGGTACAGAGCTTCAGTTTGG - Intergenic
972315805 4:37924495-37924517 ATGGCTACAGAGTTTCTGGTGGG - Intronic
972508762 4:39747316-39747338 ATGGGTACGAAGTTTCAGTTTGG - Intronic
972544436 4:40066829-40066851 CTGGGTACAGAGTTTCAGTTTGG - Intronic
972725009 4:41739269-41739291 AAGGATACAATGTTTCAGTTAGG + Intergenic
972744388 4:41919389-41919411 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
973242739 4:47974462-47974484 AAGGATACAATGTTTCAGTTAGG + Intronic
973242751 4:47974567-47974589 AAGGATACAATGTTTCAGTTAGG + Intronic
974085079 4:57251665-57251687 AAGGTTACAAAGTATCAGCTGGG + Intergenic
974498352 4:62663176-62663198 AAGGTTACAAAGTTTCAGTTAGG - Intergenic
974615732 4:64278715-64278737 AAGGATACAAAGTTACAGCTTGG - Exonic
974773321 4:66444862-66444884 ATGGGTACAGAGTTTTAGTTTGG + Intergenic
975242027 4:72071262-72071284 ATGAATTCATAGTCTCAGCTAGG - Intronic
975385701 4:73757227-73757249 ATGGGTACAGAGTTTCAATTTGG - Intergenic
975636256 4:76452344-76452366 ATGGATACAGAGTTTCAGTTTGG - Intronic
975927125 4:79470573-79470595 ATTAATACAAAGTTTCAGTTTGG - Intergenic
976171068 4:82304844-82304866 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
976252236 4:83064471-83064493 ATAGGTACAGAGTTTCAGTTTGG - Intronic
976264387 4:83176451-83176473 ATGGATAAGCAGCTTGAGCTGGG - Intergenic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976564057 4:86533276-86533298 ATGGGTACAGAGTTTCAGCATGG + Intronic
976645710 4:87385452-87385474 ATGGGTACAGATTTTCATCTTGG + Intronic
976879651 4:89904402-89904424 ATGGGTACAGAGCTTCAGTTTGG - Intronic
976894042 4:90085673-90085695 ATGGATACAAAGATTCTGTTTGG - Intergenic
977437136 4:97012630-97012652 ATGGAAACACTGTTTAATCTGGG + Intergenic
977507595 4:97922051-97922073 ATGGTTACAAAGTTTCTGATAGG + Intronic
977550697 4:98439955-98439977 ATGAGTACAGAGTTTCAGTTTGG - Intronic
977749969 4:100597772-100597794 ATGAATACAGAGTTTCAGTTTGG - Intronic
977833840 4:101624666-101624688 TTGGATACAGAGTTTCAGTCTGG + Intronic
978275780 4:106948045-106948067 ATGGATACAGAGTTTTATTTAGG - Intronic
978464372 4:108993138-108993160 AAGGATACAAAATTCCAGCTAGG - Intronic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
978822068 4:112978440-112978462 ATGTGTACAGAGTTTCAGTTTGG - Intronic
978851682 4:113344939-113344961 ATAGATACAGAATTTCAGTTAGG + Intronic
979175288 4:117655349-117655371 AATGATACAAAGTTTCAGTTAGG + Intergenic
979274806 4:118803118-118803140 ATGGGTACAGAGTTTCAGTGTGG + Intronic
979836101 4:125369735-125369757 ATGGGTAGAGAGTTTCAGTTTGG - Intronic
980341294 4:131550708-131550730 AAGGATACAAAATTTCAGTTAGG - Intergenic
981661254 4:147169246-147169268 ATGGACATAGAGTTTCAGTTTGG + Intergenic
981785631 4:148476465-148476487 AAGGATACACAATTTCAGTTAGG + Intergenic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
982474211 4:155830715-155830737 ATGCGTACAGAGTTTCAGTTAGG - Intronic
982506703 4:156227709-156227731 ATGAATACACAAATTCAGATGGG + Intergenic
982854850 4:160368476-160368498 ATGGATACAGAGTTTGAGTTTGG + Intergenic
983187905 4:164721726-164721748 ATGGGTACAGAGTTTCAGATTGG - Intergenic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
983571897 4:169217715-169217737 ATGGATACAGAGTTTTAGCTGGG + Intronic
983933231 4:173475954-173475976 ATGGATATAGAGTTTCAGTTTGG + Intergenic
984004163 4:174288389-174288411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984977658 4:185243617-185243639 ATGGGTATAGAGTTTCAGTTTGG - Intronic
984982007 4:185291323-185291345 ACGGATACGAAGTTTCAGTTTGG - Intronic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985172457 4:187166447-187166469 ATGGGTATAGAGTTTCAGCTGGG + Intergenic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
985483759 5:137282-137304 ATGGGTTCACCGTTTCAGTTTGG + Intergenic
985960304 5:3297380-3297402 ATGGAGACAGAGTTTTAGTTTGG - Intergenic
986390336 5:7279911-7279933 AGGGTTTCACAGTTTTAGCTAGG + Intergenic
986442320 5:7793151-7793173 AAAGACACACAGTGTCAGCTGGG + Intronic
986673147 5:10160909-10160931 ATGTCTACACAGTTCCAACTTGG + Intergenic
986914859 5:12607061-12607083 ATGGGTAAAGAGTTTCTGCTTGG + Intergenic
987156567 5:15095560-15095582 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
987662735 5:20898245-20898267 CTGGCTACAGAGTTCCAGCTTGG + Intergenic
987843275 5:23248630-23248652 AAGGATACACACTTCCAGTTAGG - Intergenic
988759957 5:34303949-34303971 CTGGCTACAGAGTTCCAGCTTGG - Intergenic
989132450 5:38121060-38121082 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
989227242 5:39043496-39043518 ATGGGTACAAAGTTACAGTTAGG + Intronic
989242264 5:39215054-39215076 ATGGATATAGAGTTACAGTTGGG + Intronic
989397511 5:40974170-40974192 ATGGATATAGAGCTTCAGTTTGG - Intronic
991137806 5:63203676-63203698 ATAGATACAAAATTACAGCTGGG - Intergenic
991224356 5:64252321-64252343 AAGGATACAAAATTTCAGTTAGG + Intronic
991296764 5:65089897-65089919 ATGGATTCACAGTGACTGCTAGG - Intergenic
991357408 5:65783167-65783189 ATGGTTACAGAGTTTCTGTTTGG + Intronic
991453707 5:66780180-66780202 ATGGGTACAAAGTTTCAGTTTGG - Intronic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
991735057 5:69624272-69624294 ATGGATACAGAGTTTCCTTTGGG - Intergenic
992000512 5:72431793-72431815 ATGGGTGCAGAGTTTCTGCTTGG + Intergenic
992304907 5:75426806-75426828 ATGGACACAGAGTTTCAGCTGGG + Intronic
992350895 5:75928211-75928233 ATGGATACAAAGTTTCTGTTTGG - Intergenic
992537190 5:77718928-77718950 AAGGATCCACAGTGTCAGCTTGG - Intronic
993069926 5:83147586-83147608 AAGGATACACAATTTCAATTAGG + Intronic
993074496 5:83211465-83211487 GTGCATGCACACTTTCAGCTAGG - Intronic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993699054 5:91096836-91096858 ATGGATATAGAGTTTCTGTTTGG - Intronic
993761896 5:91806013-91806035 ATGGAAACATTGTTTCAGGTTGG + Intergenic
993811508 5:92484205-92484227 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
994088117 5:95782404-95782426 TTGGGTACAGAGTTTCAGTTTGG + Intronic
994296139 5:98090605-98090627 AAGGATACAAAATTTTAGCTAGG - Intergenic
994651500 5:102534751-102534773 ATGGATACAGAGTTTCAATCTGG + Intergenic
994673358 5:102789661-102789683 ATAGGTACAGAGTTTCAGTTTGG + Intronic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
994963135 5:106630135-106630157 AAGGATACAGAGTTTCAGTTAGG + Intergenic
995007302 5:107215420-107215442 ATGGGTACGAAGTTTCAGTTTGG + Intergenic
995397212 5:111699628-111699650 ATGGATTCACAGCATCAGTTTGG + Intronic
995762430 5:115577561-115577583 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
995988535 5:118208590-118208612 ATTGACTCACAGTTTCAGCATGG - Intergenic
996269821 5:121589815-121589837 ATGAGTACAAAGTTTCAGTTAGG + Intergenic
996632585 5:125652252-125652274 GTGGGTACAAAGTTTCAGTTAGG + Intergenic
996792663 5:127309405-127309427 ATGGGTACAGAGTTTCAATTTGG - Intronic
996886803 5:128366185-128366207 GTAGATACACATTTTCATCTTGG - Intronic
997112094 5:131086611-131086633 ATAGGTACACAGTTTCAGATTGG - Intergenic
997169844 5:131706114-131706136 ATGGATACAGAGTTTCAGCTGGG + Intronic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
997329563 5:133050073-133050095 AGGGATACAGAGTTTCAGTTTGG - Intergenic
997478603 5:134165108-134165130 ATGGGTACAGAGTTTCAGTGTGG + Intronic
997897402 5:137731958-137731980 ATGGATAGAGAGTTTCAGTTTGG - Intronic
998015764 5:138730770-138730792 ATGGATATGGAGTTTCAGTTTGG + Intronic
998165587 5:139841007-139841029 ATGTGTACAGAGTTTCAGTTTGG - Intronic
998268498 5:140685321-140685343 ATGGGTACAGAGTTTCAATTGGG + Intronic
998303301 5:141047487-141047509 AAGGATACAAAATTTCAGTTAGG + Intergenic
998429232 5:142056280-142056302 ATGGATATACAGTTTCTTTTGGG + Intergenic
998801111 5:145870196-145870218 ATGGATACAGAGTTTCAATTTGG - Intronic
998808988 5:145947100-145947122 ATGGGTACAGAGTTTCAGTATGG - Intronic
998946638 5:147347055-147347077 AAGGATATACATTTTCAGCAAGG + Intronic
998994015 5:147850955-147850977 ATGGGTACAAAGTTACAGTTAGG - Intergenic
999367920 5:151034915-151034937 ATGGATGCACAGTGTGTGCTCGG - Intronic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999696661 5:154193056-154193078 ATGGATAGACAGGCTCATCTGGG + Intronic
999794555 5:154976943-154976965 ATGGATACAGAGTTTCAGATGGG - Intergenic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1000699066 5:164425416-164425438 AAGGATACAAAATTTCAGTTAGG + Intergenic
1001442595 5:171755740-171755762 ATGGTTACATAGTTTCTGTTTGG + Intergenic
1001511382 5:172325058-172325080 ATGGGCACACAGTTTCATTTTGG + Intergenic
1001784481 5:174400379-174400401 ATGGGTACCGAGTTTCAGTTGGG + Intergenic
1001923051 5:175615846-175615868 ATGGGTGCAGAGTTTCAGCAGGG + Intergenic
1002005851 5:176234182-176234204 ATGGGTATTGAGTTTCAGCTTGG - Intergenic
1002130655 5:177079612-177079634 ATGGATACACTGTTTCATTTAGG + Intronic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002165675 5:177343806-177343828 ATGGGTAGAGAGTTTCAGTTGGG + Intronic
1002211762 5:177603706-177603728 ATGGAGCCACGGTTTCTGCTGGG + Intronic
1002334544 5:178468876-178468898 ATGGGTGCAGAGTTTCAGCAGGG - Intronic
1002341850 5:178521875-178521897 ATGGTTACACAGTTTCTGTTTGG + Intronic
1002372314 5:178765021-178765043 ATGGGTACATAGTTTTAGTTTGG - Intergenic
1002703189 5:181141880-181141902 GAGTATACACAGTTTCAGTTAGG - Intergenic
1002713282 5:181208122-181208144 ATGGGTTCAGAGTTTCATCTGGG - Intergenic
1002791015 6:437558-437580 ATGGAGACAGAGCTTCAGTTTGG - Intergenic
1002908997 6:1473844-1473866 ATGGGTGCAGAGTTTCAGTTTGG - Intergenic
1003092673 6:3117625-3117647 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1003269978 6:4599935-4599957 ATGGATGCAGATTTTCACCTTGG - Intergenic
1003295578 6:4823851-4823873 ATGGTTACAGAGTTTCTGTTTGG - Intronic
1003509849 6:6770678-6770700 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003536264 6:6978260-6978282 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1003597207 6:7484697-7484719 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1003934283 6:10959419-10959441 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1003968401 6:11275284-11275306 AAGGATACAAAATTTCAGTTAGG + Intronic
1004041909 6:11987686-11987708 AAGGATACAAAGTTTCAATTGGG - Intergenic
1004204204 6:13575763-13575785 AAGGATACAAAGTTTTAGTTAGG - Intronic
1004237805 6:13890044-13890066 ATAAAGTCACAGTTTCAGCTGGG - Intergenic
1004735091 6:18397945-18397967 ACGGGTACAGAGTTTCTGCTTGG - Intronic
1004784466 6:18951153-18951175 ACGGATACAAAGTTACAGTTAGG + Intergenic
1004953050 6:20695896-20695918 ATGGGTACAGAGTTTTAGTTTGG - Intronic
1004978123 6:20991292-20991314 ATGGGTACAGAGTTTCAGTCTGG + Intronic
1004998141 6:21214192-21214214 AGGGTTACAGAGTTTCTGCTTGG + Intronic
1005036346 6:21558545-21558567 ATGAGTACAGAGTTTCTGCTTGG - Intergenic
1005062529 6:21790345-21790367 ATGGGTACAGAGTTTCAGGTTGG - Intergenic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1005589201 6:27307591-27307613 AAGGGTACAAAGTTTCAGATAGG - Intronic
1005625281 6:27656631-27656653 ATGGTTATAGAGTTTCAGTTTGG + Intergenic
1005769808 6:29056919-29056941 AAGGATACAAAATTTCAGTTAGG - Intergenic
1006181957 6:32159121-32159143 ATGGGTATACGGTTTCAGTTTGG - Intronic
1006243701 6:32710029-32710051 ATGGTTACAGAGTTCCAGTTTGG - Intergenic
1006306698 6:33225699-33225721 AAGGATACAAAATTTCAGTTAGG + Intergenic
1006351233 6:33522476-33522498 ATGGGTACAGAGTTGCAGTTTGG - Intergenic
1006406617 6:33849283-33849305 ATGGATGCACAGCCCCAGCTTGG - Intergenic
1006476901 6:34261611-34261633 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1006594171 6:35180710-35180732 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1006874990 6:37287516-37287538 ATGGATACAGAGTTCCAGTTTGG - Intronic
1007314832 6:40978991-40979013 ACGGGTCCACTGTTTCAGCTGGG + Intergenic
1007544499 6:42682275-42682297 ATGAGTACAGAGTTTCAGTTGGG + Intronic
1007650212 6:43414752-43414774 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1007859394 6:44891626-44891648 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008608163 6:53160656-53160678 ATGCGTACAGAGTTTCAGTTTGG - Intergenic
1009473368 6:64056513-64056535 ATAGAAACACAGTTCCAGTTTGG - Intronic
1009548312 6:65051656-65051678 AAGGATACAAAATTTCAGTTAGG - Intronic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1011152844 6:84293381-84293403 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1011471950 6:87716780-87716802 TTGGGTACAAAGTTTCAGTTAGG + Intergenic
1011567965 6:88699941-88699963 ATGGCTACAGAGTTTCTGTTTGG + Intronic
1011637558 6:89388362-89388384 ATGGGTATGTAGTTTCAGCTGGG + Intronic
1011658164 6:89570518-89570540 ATGGGTATAGAGCTTCAGCTGGG - Intronic
1011659564 6:89582594-89582616 ATGGGTACAAAGTTACAGTTTGG - Intronic
1011749100 6:90437575-90437597 ATGAGTACAGAGTTTCATCTGGG - Intergenic
1011784005 6:90824012-90824034 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1011951744 6:92975364-92975386 AAGGATACAAAATTACAGCTAGG + Intergenic
1012435663 6:99212508-99212530 ATGGAAACACATTCTTAGCTGGG + Intergenic
1012458017 6:99428660-99428682 ATGGGTACAGAGTTTCCGTTTGG + Intergenic
1012478765 6:99644206-99644228 AAGGATACACAATTTCAGTTAGG + Intergenic
1012479020 6:99647494-99647516 ATGGATCTAGAGTTTAAGCTAGG + Intergenic
1012733321 6:102909051-102909073 AAGGATACAAAATTTCAGTTAGG - Intergenic
1013150007 6:107436614-107436636 AAGGATACAAAATTTCAGTTGGG + Intronic
1013252860 6:108352076-108352098 ATGGACACAGAGTTTCAGTTTGG - Intronic
1013420616 6:109963244-109963266 ATGGGTACAAAATTACAGCTAGG + Intergenic
1013783862 6:113757737-113757759 ATGGGTACACAGTTTCAATTTGG - Intergenic
1014250536 6:119111388-119111410 ATGGATACAGAGTTTCAGTTGGG + Intronic
1014334054 6:120109171-120109193 AGGGGTACAAAGTTTCAGTTAGG - Intergenic
1014375220 6:120663992-120664014 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1014426230 6:121310127-121310149 AAGGATACAAAATTTCAGTTAGG + Intronic
1014793005 6:125695865-125695887 AAAGGTACACAGTTTCAGTTAGG + Intergenic
1014797104 6:125738036-125738058 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1014921621 6:127220476-127220498 ATTGCTACACCATTTCAGCTGGG - Intergenic
1015037215 6:128670176-128670198 ATGGGTACAAAGTTTCAGTTAGG + Intergenic
1015168661 6:130227084-130227106 ATGGGTACAGAGTTTCATTTTGG - Intronic
1015607461 6:134973470-134973492 ATGGGTACAGATTTTCAGTTTGG + Intronic
1015618236 6:135101785-135101807 ATGGATACAGAGTTTCATTTTGG - Intronic
1015958573 6:138623628-138623650 AAGGATACAAAATTTCAGTTAGG - Intronic
1016863200 6:148742492-148742514 AAGGATACAAAATTTCAGCTAGG - Intergenic
1017646518 6:156544235-156544257 ATGAGTACAGAGTTTCAGTTTGG - Intergenic
1017846953 6:158266930-158266952 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1018334123 6:162766178-162766200 ATGGGGACAAAGTTTCAGATAGG - Intronic
1018459196 6:163981316-163981338 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
1018700207 6:166420371-166420393 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1019694261 7:2436256-2436278 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1019810351 7:3160623-3160645 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1019923318 7:4176610-4176632 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1019953585 7:4393095-4393117 ATGGGGACACAGTTTCCGTTTGG + Intergenic
1020115565 7:5474203-5474225 ATGGGGACAGAGTTTCAGTTGGG + Intronic
1020174973 7:5874895-5874917 ATGGGGACAGAGTTTCAGATTGG - Intergenic
1020247602 7:6442007-6442029 GTGGAGACACAGCTTCAGCCAGG + Intronic
1020579913 7:9984074-9984096 AAGGATACAAAGTTACAGTTAGG - Intergenic
1020667699 7:11068556-11068578 AGGGGTACAGAGTTTCAGCTGGG + Intronic
1021498402 7:21301980-21302002 ATGGGTACTGAGTTTCAGTTTGG + Intergenic
1021538444 7:21730716-21730738 AGGGATACAAAATTTCAGTTAGG + Intronic
1021763758 7:23926672-23926694 ATGGGTGCAGAGTTTCTGCTTGG - Intergenic
1021768468 7:23973038-23973060 AAGGATACAAAATTTCAGTTGGG - Intergenic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021915702 7:25430314-25430336 ATGGGTACAAAGTTTCTGTTTGG - Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1022215534 7:28257113-28257135 AAGGATACAAAGTATCAGTTAGG - Intergenic
1022322755 7:29302721-29302743 ATCGGTACAGAGTTTCAGTTTGG - Intronic
1022378023 7:29833191-29833213 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1022420242 7:30213503-30213525 ATGGGTACACAGTTCCTGTTTGG - Intergenic
1022425414 7:30264264-30264286 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1022455542 7:30555261-30555283 ATGGGTATAGAGTTTCACCTTGG - Intergenic
1022697148 7:32718445-32718467 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1022797121 7:33741020-33741042 ATGGATATAGAGTTTCAGTTTGG - Intergenic
1022933658 7:35149532-35149554 ATGTATACAAAGTTTCAGTTAGG + Intergenic
1022940121 7:35227831-35227853 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1023196879 7:37650560-37650582 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1023223980 7:37949988-37950010 ATGGAGACAGAGTTTCAGTTTGG + Intronic
1023292716 7:38685147-38685169 AAGGATACAAAATTTCAGTTAGG + Intergenic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023596768 7:41837704-41837726 ATGGATACAAAGTTTTAGTTTGG - Intergenic
1023877892 7:44299403-44299425 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1024567831 7:50697165-50697187 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1024673686 7:51619249-51619271 CAGGATACAAAGTTTCAGTTAGG + Intergenic
1024799070 7:53054993-53055015 ATGGATGCACAGTTACAGTTAGG + Intergenic
1024854900 7:53767190-53767212 ATGGGTATACAGTTTCAGTTTGG - Intergenic
1024960163 7:54966035-54966057 ATGGGTACAGAGTTTCTGCTTGG - Intergenic
1025067172 7:55867250-55867272 ATGGATATAAAGTTTTAGTTTGG - Intergenic
1025968102 7:66294148-66294170 ATGGGTACAGAATTTCAGTTTGG - Intronic
1027715363 7:81662602-81662624 ATGGACACATTGATTCAGCTGGG + Intergenic
1028193947 7:87883297-87883319 ATGGGTACAGACTTTCAGTTTGG + Intronic
1028205899 7:88016816-88016838 ATGGATACAAAATTACAGCTAGG + Intronic
1028268054 7:88752674-88752696 AAGGATACAGAGTTTTAGATAGG + Intergenic
1028283507 7:88964550-88964572 ATGCATACAGAGTTTCAATTGGG + Intronic
1028646209 7:93099290-93099312 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1028924349 7:96341318-96341340 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1029083805 7:97995748-97995770 ATGGGGACAGAGTTTCAGATTGG + Intergenic
1029561534 7:101306199-101306221 ATGGTTATAGAGTTTCAGTTAGG + Intergenic
1029829589 7:103242302-103242324 ATGCATACAAAGTTTCAGTTAGG + Intergenic
1030043726 7:105475808-105475830 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1030057278 7:105594378-105594400 ATGCATTCTCAGTTTCAGCCAGG - Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030250342 7:107436474-107436496 ATGACTACAGAGTTTCAGGTTGG + Intronic
1030331041 7:108270897-108270919 ATGGGTTTAGAGTTTCAGCTGGG + Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1030636918 7:111960657-111960679 AAGGATACAAAATTTCAGTTAGG - Intronic
1030789408 7:113705573-113705595 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1030875789 7:114811537-114811559 AAGGATACAAAATTTCAGTTAGG + Intergenic
1031356325 7:120791361-120791383 AAGGATACAAAATTTCAGTTAGG + Intronic
1031925047 7:127631035-127631057 ATGGGTACAGAGTGTCTGCTTGG - Intergenic
1032059473 7:128712436-128712458 ATGGGTGCAGAGTTTCAGTTAGG - Intronic
1032122206 7:129165102-129165124 ATGGATACAGAGTTTCATCTGGG - Intronic
1032496020 7:132363305-132363327 ATGGATTCAGAGTTGCAGTTTGG - Intronic
1032518535 7:132525032-132525054 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1032519295 7:132531095-132531117 ATGGCAACAGAGTTTCAGTTGGG + Intronic
1032596747 7:133248659-133248681 ATGGATACAGAGTTTCATTTTGG - Intergenic
1032680807 7:134180857-134180879 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1032887147 7:136152873-136152895 GTGGATATAGAGTTTCAGTTAGG + Intergenic
1033256338 7:139804812-139804834 ATGGACTCACAGTTTCACATGGG - Intronic
1033326980 7:140388051-140388073 AAGGATACAAAATTTCAGTTAGG - Intronic
1033349517 7:140550763-140550785 ATGGGTACAGAGTTTCTGTTGGG + Intronic
1033401730 7:141032529-141032551 AAGGATACAGAATTTCAGATAGG + Intergenic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1033928371 7:146491913-146491935 AAGGATACAGAGTTTCAGGGAGG - Intronic
1034146517 7:148878232-148878254 ATGAATACAGAGTTTCTGTTTGG - Intronic
1034475396 7:151278640-151278662 ATGGATACAGAGCTCCAGTTTGG - Intergenic
1034527165 7:151672497-151672519 ACGGAGACAGAGTTTCAGTTTGG - Intronic
1035109058 7:156465047-156465069 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1035205344 7:157290868-157290890 ATGGGGACAGAGATTCAGCTTGG + Intergenic
1035540179 8:428660-428682 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1036015773 8:4782146-4782168 ATGGGTACAAAGTTACAGTTAGG + Intronic
1036038454 8:5046670-5046692 AAGGAAACACAGCTTCAGCAAGG - Intergenic
1036137710 8:6176860-6176882 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1036218336 8:6899636-6899658 ATGGGTACAGAGTTTCCACTGGG - Intergenic
1036378510 8:8220705-8220727 ATGGATACAGGGTTTCTTCTGGG + Intergenic
1036654261 8:10666049-10666071 ATGCATACAGAGTTTCAGTTTGG + Intronic
1036705995 8:11047647-11047669 ATGGAGACAGAGCTTCAGTTTGG + Intronic
1036720433 8:11169656-11169678 ACGGGTACAGAGTTTCTGCTAGG + Intronic
1036769543 8:11569575-11569597 ATGGAGACAGAGTTTCAGTTTGG - Intergenic
1036772827 8:11590865-11590887 ATGGGTACAGAATTTCAGTTAGG + Intergenic
1036791465 8:11723935-11723957 ATGGGTACAGAGTTTCACTTGGG - Intronic
1036821806 8:11946071-11946093 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
1036851063 8:12201913-12201935 ATGGATACAGGGTTTCTTCTGGG - Intergenic
1036872427 8:12444194-12444216 ATGGATACAGGGTTTCTTCTGGG - Intergenic
1038100031 8:24362895-24362917 ATGGATATAGAGTTTCTGTTTGG - Intergenic
1038119560 8:24597438-24597460 AAAGATACACAGTTTAAACTTGG - Intergenic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038208964 8:25497601-25497623 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1038230845 8:25698124-25698146 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1038371306 8:26994578-26994600 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1038444019 8:27590781-27590803 ATGGGTACAGAGCTTCAGTTAGG + Intergenic
1038566996 8:28627956-28627978 ATGGGTACAGAGTTTCAGCCTGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038771307 8:30483721-30483743 AGGGCTACAGAGTTTCTGCTTGG - Intronic
1039294557 8:36135782-36135804 ATGGATATAGAGTTTCAGTTTGG + Intergenic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039953995 8:42193515-42193537 ATGGCTACAGAGTTTCAGTTAGG - Intronic
1040361298 8:46666821-46666843 ATGGATATAAAGTTTTAGTTTGG + Intergenic
1040924500 8:52664161-52664183 AGGGATACCCAGTTGAAGCTAGG - Intronic
1040994098 8:53384013-53384035 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1041093782 8:54329197-54329219 ATGGGTACAGAGAGTCAGCTTGG - Intergenic
1041098655 8:54374266-54374288 ATGGGTACACAGTTTCGGTTTGG + Intergenic
1041206294 8:55501417-55501439 ATGGGTACAGAATTTCAGTTTGG - Intronic
1041339325 8:56825580-56825602 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1041622149 8:59984065-59984087 AAGGATACAAAATTTCAGTTAGG - Intergenic
1041687564 8:60658329-60658351 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1041688678 8:60668063-60668085 ATGGGTACACAGTGTCTGTTGGG + Intergenic
1041855322 8:62446580-62446602 ATGGACATAGAGTTTCAGTTTGG - Intronic
1042118340 8:65457039-65457061 ATGGGTTCAGAGTTTCAGTTTGG + Intergenic
1042266887 8:66917531-66917553 ATGGGTACGCAGTTTCAGTTTGG - Intronic
1042461867 8:69079362-69079384 ATGGATTGACAGTTTCAGGTGGG - Intergenic
1042783577 8:72521025-72521047 ATGGATACAAAATTTCTGTTTGG + Intergenic
1042952235 8:74212788-74212810 ATGGGTACAAAGCTTCAGTTTGG - Intergenic
1042959322 8:74286524-74286546 ATGGGTACAAAGTTACAGTTAGG - Intronic
1043404105 8:79913318-79913340 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1043705906 8:83350406-83350428 ATGGGTATACAGTTTCAGTTTGG - Intergenic
1044205489 8:89488280-89488302 ATAGATACACAGTTTTAAATTGG - Intergenic
1044648082 8:94466032-94466054 ATGGGTACAGAGTTTCTGTTTGG + Intronic
1044661822 8:94599091-94599113 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1044716949 8:95108581-95108603 ATGGGTAGAAAGTTTCTGCTTGG + Intronic
1045014013 8:97983011-97983033 ATGGGTACAGCGTTTCAGTTTGG - Intronic
1045119446 8:99019600-99019622 ATGGATACAGAATTTCAGTTTGG - Intronic
1045157609 8:99494267-99494289 ACGGATACAGAATTTCAGTTGGG - Intronic
1045180193 8:99772488-99772510 ATGGACATGGAGTTTCAGCTTGG + Intronic
1045194752 8:99919233-99919255 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1045289467 8:100820143-100820165 GTGGGTACAAAGTTTCAGCTTGG + Intergenic
1045431543 8:102119438-102119460 GTGGAAACAGAGTTTCAGCTGGG + Intronic
1045485088 8:102624849-102624871 ATAGATACAGAGTTTCAGTTTGG - Intergenic
1045862096 8:106825085-106825107 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1046662504 8:116963401-116963423 ATGGATACAGCGTTTCATTTGGG - Intronic
1046873851 8:119231943-119231965 AAGGATACAGAATTTCAGTTAGG + Intronic
1047244037 8:123122559-123122581 ATGGATACAGAGTTTCTATTTGG + Intronic
1047269354 8:123340817-123340839 ATAGGTACAGAGTTTCTGCTTGG + Intronic
1047775109 8:128063737-128063759 AAGGATATACAATTTCAGTTAGG + Intergenic
1048103866 8:131385825-131385847 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1048261356 8:132948067-132948089 ATGGACACACAGTCTCTGCTTGG + Intronic
1048816776 8:138341450-138341472 GTGGGTTCAGAGTTTCAGCTGGG + Intronic
1049011313 8:139889514-139889536 ATGGGTGCCCAGTTTCAGTTTGG + Intronic
1049916582 9:323625-323647 ACGGGTACAGAGTTTCAGTTTGG - Intronic
1049986481 9:956297-956319 ATGGGTACAGAATTTCAGTTTGG + Intronic
1050083440 9:1939283-1939305 AGCAATACACAGTTTCAGGTTGG + Intergenic
1050256023 9:3793017-3793039 ATGGATACAGAGTTTCAGGTGGG + Intergenic
1050708177 9:8428083-8428105 AAGGTCACACAGTTTGAGCTAGG + Intronic
1051071457 9:13173142-13173164 ATGGATACAGCGTTTCAATTGGG + Intronic
1051330106 9:16015741-16015763 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1051376068 9:16404231-16404253 ATGGGTACAGAGTTTCATTTGGG + Intergenic
1051485440 9:17603496-17603518 ACGGGTACAGAGTTTCAGATGGG + Intronic
1051566316 9:18503167-18503189 ATGGATGCAGAATTTCAGTTAGG - Intronic
1052334993 9:27309954-27309976 AAGGACACAAAATTTCAGCTAGG + Intergenic
1052344472 9:27395183-27395205 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1052470869 9:28894956-28894978 AAGGATACAAAATTTCAGTTAGG - Intergenic
1052798294 9:32944413-32944435 AAGGATACAAAATTTCAGTTAGG - Intergenic
1053112250 9:35471554-35471576 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1053317360 9:37063337-37063359 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1053420801 9:37976443-37976465 ATGGGTACAGGGTTTCAGTTTGG - Intronic
1053695207 9:40632618-40632640 ATGGATACAACATTACAGCTAGG + Intergenic
1053704669 9:40738712-40738734 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1053942193 9:43263004-43263026 ATGGATACAAAATTACAGCTAGG + Intergenic
1054306451 9:63431843-63431865 ATGGATACAACATTACAGCTAGG + Intergenic
1054405190 9:64755835-64755857 ATGGATACAAAATTACAGCTAGG + Intergenic
1054414749 9:64862319-64862341 ATGAGTACAGAGTTTCAGTTTGG + Intergenic
1054438815 9:65241325-65241347 ATGGATACAAAATTACAGCTAGG + Intergenic
1054491589 9:65780621-65780643 ATGGATACAAAATTACAGCTAGG - Intergenic
1054877602 9:70112946-70112968 ATGGAGACACAGTCACACCTGGG - Intronic
1055090610 9:72362263-72362285 ATTAATAAACACTTTCAGCTGGG + Intronic
1055245598 9:74238878-74238900 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1055356204 9:75439405-75439427 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1055732736 9:79295534-79295556 CTGGTTTCACAGTTTTAGCTTGG - Intergenic
1055841692 9:80512841-80512863 ATGGGTACACAGTTTAAGTTTGG - Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1056444561 9:86653334-86653356 ATGGGTATAGAGTTTCAGCAAGG - Intergenic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1056837244 9:89966460-89966482 ATGGATACATAGTTTCTGTTTGG + Intergenic
1057203311 9:93155405-93155427 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1057246791 9:93462655-93462677 GTGGGTACACAGTTCCAGTTTGG - Intronic
1057350205 9:94290365-94290387 ATGGATACACAATTTCTATTTGG - Intronic
1057539507 9:95953099-95953121 ATGAGTACAGAGTTTCAGTTTGG + Intronic
1057673425 9:97116508-97116530 ATGGATACAGAATTTCAGTTTGG + Intergenic
1057875426 9:98750124-98750146 ATGGATACACGGTTTCTTTTGGG - Intronic
1058469398 9:105261746-105261768 AGAGAAACACAGATTCAGCTGGG - Intronic
1058677365 9:107411872-107411894 ATGGGTACAGAGTATCAGTTGGG + Intergenic
1058853973 9:109041608-109041630 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1058905485 9:109479151-109479173 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1058957833 9:109965602-109965624 ATGGGTACAGAATTTCAGTTTGG + Intronic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059621371 9:116009349-116009371 ATGGGTACAGAGTTTCAACTGGG - Intergenic
1059631918 9:116134214-116134236 ATGGGTATACAATTTCAGCTGGG + Intergenic
1060099035 9:120821627-120821649 ATGGATACAGAGTTTCAGTTTGG - Intronic
1060100442 9:120835971-120835993 ATGGATGCAGAGTTTCTGGTTGG - Intronic
1060257543 9:122045920-122045942 ATGGGTACAGAGTGTCAGTTTGG + Intronic
1060263437 9:122094721-122094743 ATAGACACAAAGTTTCAGTTTGG - Intergenic
1060298440 9:122359313-122359335 ATGAATGCAAAGTTTCAGTTAGG - Intergenic
1060469423 9:123935379-123935401 ATGGGTATAAAGTTTCAGTTTGG - Intergenic
1060699205 9:125736148-125736170 ATGGGTACAGGTTTTCAGCTTGG + Intergenic
1060799986 9:126537837-126537859 ATAGAAAAACAGTCTCAGCTCGG - Intergenic
1061503356 9:131016276-131016298 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1061560749 9:131401301-131401323 ATGGGAACAGAGTTTCAGTTTGG - Intronic
1061662581 9:132139955-132139977 ATGGATACAGAGTTTTACCTTGG - Intergenic
1061782870 9:133006080-133006102 ATGGGTACAGAGCTTCAGTTTGG + Intergenic
1062667676 9:137685220-137685242 ATGGATACAGAGTTTCTGCTTGG - Intronic
1062728521 9:138094287-138094309 ATGGATACAGAGTTTCAGTTTGG + Intronic
1062742202 9:138182120-138182142 GTGGATACAGAGTTTCACTTTGG - Intergenic
1202777649 9_KI270717v1_random:6236-6258 ATGGATACAAAATTACAGCTAGG + Intergenic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186031449 X:5373570-5373592 ATGGATACAGAGTTTCAGCTGGG - Intergenic
1186193891 X:7093121-7093143 ATGGGGACAGAGTTTCACCTTGG - Intronic
1186206941 X:7211106-7211128 AAGGATACAAAGTTTCACTTAGG - Intergenic
1186439300 X:9571695-9571717 ATGAGGACAGAGTTTCAGCTTGG - Intronic
1186487341 X:9943570-9943592 ATAGTTACGCAGTTTCAGTTGGG + Intronic
1186541092 X:10401145-10401167 ATGAATACAGAGTTTCAGTTTGG - Intergenic
1186650326 X:11552855-11552877 AAGGATACAAAATTTCAGTTAGG + Intronic
1186754144 X:12652487-12652509 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1187106337 X:16246272-16246294 ATGGATACAGAGTTTTGGCTTGG + Intergenic
1187309863 X:18131614-18131636 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1187557073 X:20362316-20362338 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1187671274 X:21668134-21668156 ATGGATACAGAGTTTCTGTTTGG - Intergenic
1187820384 X:23281395-23281417 ATGGACACAAAGTTTCTGTTTGG + Intergenic
1187909759 X:24100812-24100834 CTGTATACACAGTCTCAGCCAGG + Intergenic
1188202278 X:27305937-27305959 ATGAATACAGGGTTTGAGCTGGG - Intergenic
1188435842 X:30157596-30157618 ATGGGTACAGAATTTCAGTTTGG + Intergenic
1188511441 X:30940577-30940599 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1188952539 X:36393952-36393974 CTGGGTACAGAGTTTCAGCTTGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189418984 X:40839333-40839355 ACGGATACAGAGTTTCAATTTGG - Intergenic
1189467777 X:41290420-41290442 AGGGATACAAAATTTCAGTTTGG - Intergenic
1189621734 X:42847637-42847659 ATGGACAAAAATTTTCAGCTGGG - Intergenic
1189815996 X:44824441-44824463 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1190001921 X:46697197-46697219 AAGGATACAAAGTTTCAGTTAGG + Intronic
1190294800 X:49019724-49019746 ATGGGTACAGAGTTTCTGTTTGG - Intergenic
1190372932 X:49760468-49760490 ATGGATACAGAGTTTCTTTTAGG - Intergenic
1191854279 X:65610220-65610242 ATGGTTACAGAGTTTCCGTTTGG - Intronic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1192331710 X:70180660-70180682 ATGGATACAGAGTTTCAGTTTGG - Intronic
1192378537 X:70589045-70589067 ATGGATACAGAGTTTCTGTTTGG + Intronic
1192413608 X:70957153-70957175 ATGGATACAAAGTTTCAGTTGGG + Intergenic
1192522080 X:71811397-71811419 ATGGGTACATAGTTTCTGATTGG - Intergenic
1192524135 X:71827064-71827086 ATGGGTACATAGTTTCCGTTTGG + Intergenic
1192572309 X:72216535-72216557 ATGGGTACAGAGTTTCTGTTTGG - Intronic
1192581212 X:72283454-72283476 ATGGGTACTGAGTTTCTGCTTGG - Intronic
1192801731 X:74471772-74471794 ATAGACACAGAGTTTCAGTTTGG - Intronic
1193108879 X:77707237-77707259 ATGGGTACAGAGTTTCACTTGGG + Intronic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193132899 X:77936535-77936557 ATGGGTATAGAGTTTCAGTTTGG - Intronic
1193183028 X:78481109-78481131 ATGAATACAGAGTTTCTGTTTGG + Intergenic
1193220113 X:78914175-78914197 ATGGATACAGAATTTCAGTTTGG - Intergenic
1193242517 X:79187820-79187842 ATGGATACAAAGTTTCAGTTTGG - Intergenic
1193302773 X:79911523-79911545 ATGAATATGGAGTTTCAGCTTGG - Intergenic
1193519884 X:82516213-82516235 ATGGGTACATAGTTTCTGCTTGG + Intergenic
1193571038 X:83143770-83143792 ATGGGTACAGAGTTTCTGTTTGG + Intergenic
1193730960 X:85102330-85102352 ATGATTACAGAGTTTCAGCTGGG + Intronic
1194253700 X:91610061-91610083 ATGGGTACAAAGTTACAGCAAGG + Intergenic
1195521457 X:105835143-105835165 ATGGGCACACTTTTTCAGCTAGG + Intronic
1195630998 X:107054967-107054989 ATGGTTACCCAGTTTCATTTTGG - Intergenic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1195946451 X:110218494-110218516 ATGGGTGCAGAGTTTCAGTTTGG - Intronic
1195972165 X:110484802-110484824 ATGGCTACAGAATTTCAGTTTGG - Intergenic
1196023932 X:111020424-111020446 TTGGGTATACAGTTTCAGTTGGG + Intronic
1196136361 X:112213755-112213777 ATTGGTACAGAGTTTCAGTTTGG - Intergenic
1196211422 X:112999924-112999946 ATGGGTACAGAGATTCAGTTTGG - Intergenic
1196548335 X:116992122-116992144 ATGGATACAGAGTTTCTTTTTGG - Intergenic
1197230333 X:123997424-123997446 ATGGGTCCAGAGTTTCAGTTTGG - Intronic
1197231083 X:124004313-124004335 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1197552690 X:127913349-127913371 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1197711040 X:129667841-129667863 ATGGGTACAGTGTTTCAGTTTGG - Intergenic
1197867228 X:131032229-131032251 AAGGATATAAAGTTTCAGTTAGG - Intergenic
1198231055 X:134689984-134690006 ATGAAGACAGAGTTTCAGTTGGG - Intronic
1198327740 X:135590856-135590878 ATGGATACAGAGTTTCCTTTTGG + Intergenic
1198590517 X:138175317-138175339 ATGGGTGCAGAGTTTCAGTTTGG + Intergenic
1198776048 X:140179859-140179881 ATGAATACAATGTTTCAGGTAGG - Intergenic
1198931065 X:141860823-141860845 ATGGATAAAGAGTGTCAGTTTGG + Intronic
1199154504 X:144530760-144530782 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1200456060 Y:3394809-3394831 ATGGGTAGAGAGTTTCAGTTTGG + Intergenic
1200572483 Y:4849641-4849663 ATGGGTACAAAGTTACAGCAAGG + Intergenic
1201192989 Y:11464521-11464543 ATGGATACAAAATTACAGCTAGG + Intergenic
1201335609 Y:12877930-12877952 ATGTGTACAGAGTTTCAGTTTGG + Intergenic
1202298601 Y:23386519-23386541 ATGGATACAGAGTTTCAGTTTGG - Intergenic
1202572207 Y:26284080-26284102 ATGGATACAGAGTTTCAGTTTGG + Intergenic
1202604861 Y:26630240-26630262 ATGGGTACATAGTTTCTGTTTGG + Intergenic