ID: 1056539198

View in Genome Browser
Species Human (GRCh38)
Location 9:87556880-87556902
Sequence CACGCCCAAGGCAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056539198_1056539204 11 Left 1056539198 9:87556880-87556902 CCTCCTGGGCTGCCTTGGGCGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1056539204 9:87556914-87556936 GCCAGTCCTGCAGTTGTGGGTGG No data
1056539198_1056539203 8 Left 1056539198 9:87556880-87556902 CCTCCTGGGCTGCCTTGGGCGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1056539203 9:87556911-87556933 AGAGCCAGTCCTGCAGTTGTGGG No data
1056539198_1056539202 7 Left 1056539198 9:87556880-87556902 CCTCCTGGGCTGCCTTGGGCGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1056539202 9:87556910-87556932 AAGAGCCAGTCCTGCAGTTGTGG No data
1056539198_1056539208 17 Left 1056539198 9:87556880-87556902 CCTCCTGGGCTGCCTTGGGCGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1056539208 9:87556920-87556942 CCTGCAGTTGTGGGTGGGAGAGG No data
1056539198_1056539206 12 Left 1056539198 9:87556880-87556902 CCTCCTGGGCTGCCTTGGGCGTG 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1056539206 9:87556915-87556937 CCAGTCCTGCAGTTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056539198 Original CRISPR CACGCCCAAGGCAGCCCAGG AGG (reversed) Intronic
900288000 1:1910964-1910986 CAGGCCCAAGGGAGCCCTGTGGG + Intergenic
900547324 1:3236196-3236218 CACAGCCAGGGCAGGCCAGGGGG + Intronic
900660367 1:3779054-3779076 CACACCCACGGCAGTCCAGCTGG + Exonic
903738415 1:25544370-25544392 CTCTCCCGAGGCACCCCAGGCGG - Intronic
904210457 1:28883786-28883808 CAGGCCCAAGGCAGCCGGTGTGG - Intergenic
904252911 1:29237618-29237640 CCCGACCCGGGCAGCCCAGGGGG - Intronic
904360017 1:29965201-29965223 CACGGCCAGAGCAGCTCAGGGGG + Intergenic
904563742 1:31414791-31414813 CACCCCCAGGCCAGCCCAGCAGG - Intronic
905629639 1:39511415-39511437 CATGGTCAAGGCAGCCCAGCAGG + Intronic
905668120 1:39774775-39774797 CATGGTCAAGGCAGCCCAGCAGG - Intronic
906196409 1:43933221-43933243 CAAGCCCTAAGCAGCACAGGAGG + Intergenic
910156449 1:84225039-84225061 CACTCCCCAGGCCTCCCAGGTGG + Intronic
912489342 1:110053182-110053204 CACACACAGAGCAGCCCAGGTGG - Intronic
916998762 1:170331765-170331787 CAGGAACAAGGCAGCCCAGTGGG - Intergenic
918110634 1:181452476-181452498 CAAGCCCAAGGCATCCCTGAAGG - Intronic
920435398 1:205943734-205943756 CTCCCCCAAGGCGGCCCTGGAGG + Intergenic
921259473 1:213372713-213372735 CACCCCCAAGGTAGAACAGGTGG - Intergenic
922792709 1:228318930-228318952 GCCCCCCGAGGCAGCCCAGGAGG + Exonic
922803622 1:228374964-228374986 CCAGCCCAAGGCAGCCTGGGCGG - Intronic
1065394515 10:25219715-25219737 CACCCCAAAGGAAGCCCAAGTGG + Intronic
1065598584 10:27344812-27344834 CACACCCAAAGCAGCCCCGGGGG - Intergenic
1066653867 10:37681916-37681938 CACCCCCACGGCAGCCCAGCCGG - Intergenic
1067227548 10:44385553-44385575 GCGGCCCAAGGCAGCCGAGGGGG + Intronic
1067689793 10:48494413-48494435 CACACCTCAGGCAGCCCTGGAGG + Intronic
1068630682 10:59294387-59294409 CAGGCAAAAGGCAGCACAGGTGG + Intronic
1069879576 10:71583361-71583383 CACTCCCAAGACCCCCCAGGTGG - Intronic
1073450013 10:103603609-103603631 CAAGCCCAAGGAGGCCGAGGAGG - Exonic
1075682316 10:124341647-124341669 CAGGCCCTGGGCAGCCCAAGGGG + Intergenic
1076507264 10:130986534-130986556 CAGGCCCAGGGCAGCTCAGAAGG + Intergenic
1077041861 11:528369-528391 CACCCCCTCGGCAGCCCAGCAGG + Intergenic
1080125566 11:28729550-28729572 CAAGCCAAATGCAGCCCAGCAGG + Intergenic
1081765311 11:45606317-45606339 CACGACCAGGGCAGTTCAGGAGG + Intergenic
1083298859 11:61729793-61729815 CAGGCACAAGGCAGCACACGTGG - Intronic
1083477416 11:62923204-62923226 CAAACCCAGGGCAGCCCAGCAGG - Intergenic
1084154632 11:67306828-67306850 CTCCCCCCAGGCAGCCCAGCTGG + Exonic
1084179391 11:67438889-67438911 CGGGCCCGAGGCAGCCCTGGAGG - Exonic
1085405928 11:76262189-76262211 TACTTCCAAGGCAGCCCAGTGGG - Intergenic
1085701805 11:78752334-78752356 CACACCCAAGGTAGGCCAGTTGG + Intronic
1091277508 11:134362501-134362523 CACGGCCCAGTCATCCCAGGGGG - Intronic
1091782944 12:3225301-3225323 CACTCCCCAGCCTGCCCAGGGGG + Intronic
1092273234 12:7039498-7039520 CACGTCCAAGGCAGCTCTCGTGG - Intronic
1093262331 12:16954120-16954142 TGGGCCCCAGGCAGCCCAGGAGG + Intergenic
1094266322 12:28564609-28564631 CATGCAGACGGCAGCCCAGGGGG + Intronic
1096685151 12:53283449-53283471 CACTACCCAGGCGGCCCAGGTGG - Exonic
1096718108 12:53503052-53503074 CAAGCACAAGGCAGCTGAGGTGG + Exonic
1099590115 12:84575920-84575942 CACTTGCAAGGCAGGCCAGGTGG - Intergenic
1099625802 12:85071877-85071899 CACGTCAAGGGCAGGCCAGGTGG - Intronic
1102470850 12:113159073-113159095 CACGCCCCAGGCACCCCTGCAGG - Exonic
1102997183 12:117360155-117360177 CACGGAGAAGGCAGCCGAGGAGG - Intronic
1103593190 12:122006706-122006728 CACACCCAAGGGCGCACAGGTGG - Intergenic
1103729050 12:123013871-123013893 CCTGCCCAAGGCAGCCCTGCGGG - Exonic
1108409103 13:50129945-50129967 CTCGCCCGAGGCAGCCTAGAGGG - Intronic
1113421064 13:110171888-110171910 CATTCCCAAGGCAGCCCACCCGG + Intronic
1113952257 13:114078729-114078751 CACGCCCACGGCAGCCCTTCTGG + Intronic
1118050508 14:62021330-62021352 CACACCCATGACAGCCAAGGAGG - Intronic
1119788438 14:77329287-77329309 CAGGCCCAAAGCAGCCTGGGAGG - Intronic
1121352591 14:93185133-93185155 CGCGACCAAGGCTGCGCAGGCGG - Exonic
1122125581 14:99576844-99576866 CATGCCCAAGACAGCACAGCGGG + Intronic
1122151679 14:99729273-99729295 CACGCCCCAGGAATCCCAGATGG + Intergenic
1122482177 14:102054366-102054388 CACACCGAAGGCCGCCAAGGTGG + Intergenic
1122767906 14:104084503-104084525 CACTCCCATGAGAGCCCAGGAGG - Intergenic
1122817341 14:104320186-104320208 CCTTCCCCAGGCAGCCCAGGAGG + Intergenic
1124625033 15:31302884-31302906 CACACACAAGGCAGCTGAGGGGG - Intergenic
1128834259 15:70796565-70796587 CATGCCGATGGCAGCCCGGGGGG + Intergenic
1132576871 16:668339-668361 CTCGCCCCGCGCAGCCCAGGTGG + Exonic
1132882931 16:2170398-2170420 CCCGGCCCAGGCCGCCCAGGCGG + Intronic
1132952292 16:2570067-2570089 CAGGCCAGAGACAGCCCAGGTGG - Intronic
1132962059 16:2630103-2630125 CAGGCCAGAGACAGCCCAGGTGG + Intergenic
1133317829 16:4895069-4895091 CAAGGCCAGGGCAGCCGAGGTGG + Intronic
1134098500 16:11435524-11435546 CACGCCCAAGTCAGCCCCATTGG - Intronic
1136146160 16:28317768-28317790 GAGGCCTGAGGCAGCCCAGGGGG + Intronic
1136511220 16:30739232-30739254 CAAGCCGAAGGCGGGCCAGGCGG - Exonic
1137263373 16:46849123-46849145 CAGGCTCAAAGCAGCTCAGGAGG + Intergenic
1138528280 16:57621093-57621115 CACGCCCCAGGGAGCCAAGTTGG - Intronic
1141058638 16:80843061-80843083 CACGAGCAAGGCATCCCAAGTGG - Intergenic
1142131457 16:88433330-88433352 CCCGCCCAGGGCTCCCCAGGGGG + Exonic
1142362983 16:89636044-89636066 CAAGCACAAGGCAGGGCAGGCGG - Intronic
1142560555 17:806601-806623 CAGGCTCTGGGCAGCCCAGGAGG - Intronic
1144685621 17:17224128-17224150 CACGGCCAGGGCAGACCTGGAGG + Exonic
1145040036 17:19570911-19570933 AACACCAAAGGCAGGCCAGGTGG - Intronic
1145238935 17:21228302-21228324 CAGGCCCAAGGCAGCTCCTGAGG - Intergenic
1146054034 17:29572445-29572467 AACGGGCAAGGCAGCCCAGGGGG + Exonic
1146054064 17:29572557-29572579 CAGGGCCATGGCAGCCCAGGCGG - Exonic
1147989627 17:44324818-44324840 GACGCCGAAAGCAGCCAAGGGGG + Intronic
1148327730 17:46793535-46793557 CACGCCCAAGGCATTGCAGGAGG + Intronic
1148684251 17:49491884-49491906 CACGGCCATGGCAGCCGTGGTGG + Intergenic
1151310848 17:73291667-73291689 CCCGCCCAAGGCAGGCTATGGGG - Intronic
1152355218 17:79803581-79803603 CCGGCTCAAGGGAGCCCAGGAGG - Intergenic
1152707425 17:81851888-81851910 AACGCCCAATGCAGGCCGGGTGG + Intronic
1156350568 18:36298086-36298108 CGCGCCCAGCCCAGCCCAGGGGG - Intronic
1157083404 18:44552712-44552734 CACTCCCAAATTAGCCCAGGAGG - Intergenic
1157292791 18:46422004-46422026 CAGACCCATGGCAGCCCTGGGGG + Intronic
1160622783 18:80182207-80182229 CTCGTCAAAGGCAGCCCAGTTGG - Intronic
1160859702 19:1232491-1232513 CAGGGCCAGGGCAGCCCAGAGGG - Intronic
1160930564 19:1567935-1567957 CCCGCCCGAGGGCGCCCAGGAGG - Exonic
1161939833 19:7395335-7395357 GAGGCCCGAGGCAGCCCCGGGGG - Intronic
1162497816 19:11033247-11033269 CAGTCCCAAAGGAGCCCAGGAGG - Intronic
1163406427 19:17125954-17125976 CAAGCCCAAGCCTGCACAGGAGG - Intronic
1163638660 19:18449659-18449681 CTGGCCCAGGGCAGCCCAGGTGG - Intronic
1164677788 19:30113361-30113383 CCCTCCCATGGAAGCCCAGGGGG - Intergenic
1164725291 19:30461873-30461895 CATGCACAAGGCAGCACCGGCGG - Intronic
1164853283 19:31501941-31501963 CAGCCCTAAGGAAGCCCAGGAGG - Intergenic
1164957655 19:32400936-32400958 CACTCCCATGGCTGCCAAGGTGG + Intergenic
1165310608 19:35027511-35027533 CACGCCCGAGGCTACCCAGCAGG + Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166059964 19:40320114-40320136 CACACCCTAAGCAGCCCAAGCGG + Exonic
1166485311 19:43206862-43206884 CCTGCCCACTGCAGCCCAGGGGG - Intronic
925390011 2:3488191-3488213 CAAGCCCAAGGCATCCACGGAGG + Intergenic
926304897 2:11630875-11630897 CCCGCTCAAGGCAGGCCATGTGG + Intronic
926341660 2:11909240-11909262 CACACCCCAGGCAGGCCAGCAGG - Intergenic
927437325 2:23078024-23078046 CTCTCCCCAGGCAGCTCAGGTGG - Intergenic
927484182 2:23477609-23477631 CACGCCCATGGCACCACTGGTGG + Intronic
929602047 2:43210601-43210623 CACCCCCCAGCCAGCCCACGGGG + Intergenic
929770011 2:44883850-44883872 GACACCAAAGGCAGTCCAGGTGG + Intergenic
932791681 2:74659019-74659041 CCACCCCAAGGCAGCCCAGGGGG - Intronic
933643815 2:84793056-84793078 CATGCCCAAGCCAGCCCACAGGG + Intronic
935342532 2:102070551-102070573 CAGGCCCAAGGAAGCCAGGGCGG - Intronic
936973029 2:118192797-118192819 CTTGCCCAAGGTATCCCAGGAGG - Intergenic
938078819 2:128358233-128358255 CATGCCCAAGGGTGCCCAGCTGG - Intergenic
938467460 2:131532899-131532921 GAGGCCCCAGGCAGCCCCGGAGG + Exonic
939928360 2:148201509-148201531 CAAGGCCAAGGCAGCCCTGGAGG - Intronic
939999102 2:148949470-148949492 CATGCCGAAGGGAGCCCAGAGGG - Intronic
941561877 2:167056909-167056931 CACTCCCAAAGAAGCACAGGAGG - Intronic
946180163 2:217944097-217944119 CCCTCCCAGGCCAGCCCAGGGGG + Exonic
946475885 2:220005931-220005953 CACAGCTAAGGAAGCCCAGGAGG + Intergenic
948197471 2:236106439-236106461 CACGCACACGACAGCCCGGGTGG - Intronic
948646979 2:239411470-239411492 GACCCCCAAGGCAGGCCTGGCGG - Intergenic
948897514 2:240934216-240934238 CAAGCCCAGGGAGGCCCAGGAGG - Intronic
949003776 2:241633676-241633698 CACACCCAGGGCGGCCCAGGAGG - Exonic
1169197509 20:3691511-3691533 CAGGCCCAGGGCCACCCAGGAGG + Exonic
1170574301 20:17650816-17650838 CAAGATCAGGGCAGCCCAGGTGG + Intronic
1173789494 20:45818553-45818575 CTGGCCCAAGGCAGGCCATGTGG - Intergenic
1175295571 20:57906631-57906653 CACGCCCAAGAGAGCTCAGGTGG + Intergenic
1175994284 20:62805274-62805296 CGCGCCCGAGGCACCCCCGGGGG - Intronic
1176144848 20:63561006-63561028 CACACACAGGGCACCCCAGGTGG + Intronic
1176158877 20:63638471-63638493 CTCTCCCAGGGCAGCCCTGGTGG - Intergenic
1176625737 21:9090805-9090827 CCCGCTCAAGGAAGCCCAGATGG + Intergenic
1176681290 21:9820747-9820769 CACACCCCAGGCAGCCCCTGAGG + Intergenic
1179630231 21:42673348-42673370 CAAGCCCAGGCCTGCCCAGGTGG + Intronic
1179716214 21:43290127-43290149 CCCTCCCAAGGCAGCCATGGGGG - Intergenic
1180859154 22:19067184-19067206 CAGGCCCAAGGCAGGGCAGCAGG + Intronic
1180954472 22:19735490-19735512 CCCGCCCCAGGAGGCCCAGGAGG - Intergenic
1181372778 22:22431555-22431577 CAGGTCCAAGGCAGGCCAAGTGG - Intergenic
1182559367 22:31147728-31147750 CTTGCCCAAGGCTGCCCAGGAGG - Intergenic
1183383680 22:37503086-37503108 CAGGCCAAAGGTAGCGCAGGTGG + Intronic
1184690360 22:46114611-46114633 CAGAACCAAGGCAGGCCAGGAGG - Intergenic
1184717342 22:46289577-46289599 CAGGCCCTAGGCACCCCAGCTGG - Intronic
950472979 3:13197903-13197925 CCTGCCCAAGGCTGCCCAGCAGG + Intergenic
954711248 3:52506094-52506116 CACGCCCAGTCCTGCCCAGGAGG - Intronic
962677513 3:137767923-137767945 CGCCCCCTAGGAAGCCCAGGAGG + Intergenic
966926443 3:184647591-184647613 CAGGCACAGGCCAGCCCAGGGGG - Intronic
968008929 3:195260445-195260467 CGTGCCCGAGGCTGCCCAGGGGG - Intronic
968685004 4:1952164-1952186 AAAGCCCAAGGCAGGCGAGGTGG - Exonic
968764100 4:2459147-2459169 CAGGGCGCAGGCAGCCCAGGAGG + Exonic
969561314 4:7950137-7950159 CCCGCCCATGTCTGCCCAGGTGG - Intergenic
969714833 4:8863432-8863454 CACTCCGAAGGCAACCCAGCTGG - Intronic
974409205 4:61517362-61517384 CACGCTGAGCGCAGCCCAGGAGG + Intronic
976845808 4:89487833-89487855 CAGGCCGAAGGCAACCCAGATGG - Intergenic
981280638 4:142954564-142954586 CACGCCCAAGCCTCCCCAGCGGG + Intergenic
985825796 5:2190675-2190697 CCCACCCAGGGCTGCCCAGGCGG + Intergenic
987385380 5:17324058-17324080 CAGGACCCAGGAAGCCCAGGAGG - Intergenic
988066615 5:26233254-26233276 GCAGCCCAGGGCAGCCCAGGAGG - Intergenic
1001211339 5:169812888-169812910 AACCCCCAAGCCAGCCCTGGTGG + Intronic
1004884937 6:20042390-20042412 CATGCAGACGGCAGCCCAGGGGG + Intergenic
1005320210 6:24646086-24646108 CCCGCCGAGGGCAGCACAGGTGG + Exonic
1007754328 6:44089176-44089198 CATGCAGATGGCAGCCCAGGGGG + Intergenic
1014253636 6:119140201-119140223 CACACCCAAGGCAACTCATGAGG - Intronic
1017006980 6:150035105-150035127 CCAGCCCAGGTCAGCCCAGGAGG - Intergenic
1018172411 6:161153017-161153039 CAGGCCCAAGACAGCACAGTTGG - Intronic
1018572232 6:165223840-165223862 CATGGCCAAGGCACCCCTGGAGG + Intergenic
1018736340 6:166689610-166689632 TACCCCCCAGGCAGGCCAGGGGG + Intronic
1019695613 7:2444508-2444530 CAGGAACAAGGCAGGCCAGGAGG - Intergenic
1022408332 7:30114377-30114399 CACACCCAAGGTCACCCAGGTGG + Intronic
1023029713 7:36081432-36081454 CACACCCAAACCAGACCAGGGGG - Intronic
1026552867 7:71382606-71382628 CACACCCAGGGATGCCCAGGAGG - Intronic
1027197035 7:76037700-76037722 AACCCCCAAGACAGTCCAGGTGG + Intronic
1029203024 7:98851683-98851705 CAAGTCCAAGACAGGCCAGGTGG + Intronic
1029595875 7:101537467-101537489 CACGCCCATGGCTGCCCACCCGG + Intronic
1031857971 7:126944471-126944493 AACCCCCAACGCAGCCCAGGGGG + Intronic
1033025327 7:137766649-137766671 CACACCCAGGGCAGGACAGGAGG + Intronic
1033223350 7:139543137-139543159 CACGCCCATGGCAGCCCTGGAGG + Intronic
1034977733 7:155457973-155457995 CTCGCCCCGGGCGGCCCAGGCGG + Intergenic
1035066056 7:156105773-156105795 CAAGCTCCAGGCAGCCAAGGGGG + Intergenic
1035206955 7:157300094-157300116 CACGCTCAAGGCAGCCTCTGGGG - Intergenic
1035314292 7:157988626-157988648 CAAGCCCCAGGGAGCACAGGGGG + Intronic
1037834909 8:22210018-22210040 CTCCCCCAAGGCAGCCCACCAGG + Intronic
1039458083 8:37721104-37721126 GAAGCCCAGGGGAGCCCAGGTGG - Intergenic
1039472291 8:37821011-37821033 CACTCCCTGGGCGGCCCAGGAGG - Intronic
1040127624 8:43756038-43756060 CAAGCCCATTGCAGCCTAGGTGG + Intergenic
1040289356 8:46116478-46116500 CCTGCCCAAGACAGCCCTGGGGG + Intergenic
1040290450 8:46121465-46121487 AATGCCCAGGACAGCCCAGGGGG + Intergenic
1040306205 8:46213119-46213141 CACGCCCAGGACAGCCCTGTGGG - Intergenic
1040308622 8:46225137-46225159 CACGCCCAGGACAGCCCTGGGGG - Intergenic
1040313557 8:46249264-46249286 CATGCCCAGGACAGCCCTGGGGG - Intergenic
1040314134 8:46252018-46252040 CCTGCCCAGGGGAGCCCAGGGGG - Intergenic
1040316405 8:46263207-46263229 CTCGCCCAGGACAGCCCTGGGGG - Intergenic
1040336831 8:46420352-46420374 CCCGCCCCAGACAGCCCTGGGGG - Intergenic
1044932709 8:97265438-97265460 CTGGCCCAAAGCAGCCCAGCAGG - Intergenic
1045596203 8:103659465-103659487 CAAGCACAAGGCAGCTGAGGTGG + Intronic
1046138469 8:110061123-110061145 CTCGTCCTAGGCAGCACAGGCGG - Intergenic
1048050795 8:130814191-130814213 CTCGCCAAAGGAAGTCCAGGCGG + Exonic
1049199024 8:141330957-141330979 CACACCACAGGCTGCCCAGGTGG - Intergenic
1049240947 8:141537091-141537113 ACCGCCCAGGCCAGCCCAGGTGG - Intergenic
1049525862 8:143126690-143126712 CATGGCCCAGGCAGCCCACGGGG + Intergenic
1049686785 8:143942287-143942309 CACCCCCATCCCAGCCCAGGCGG + Intronic
1049792505 8:144478404-144478426 AACGCCCAAGGCGGCCCGGCGGG - Intronic
1056539198 9:87556880-87556902 CACGCCCAAGGCAGCCCAGGAGG - Intronic
1057442218 9:95090933-95090955 CACACCCAAGACAGCCCTGACGG + Intergenic
1059387001 9:113972451-113972473 CTGGCCCAAGGCTGCCTAGGTGG + Intronic
1060547941 9:124471584-124471606 CTTGCCCAAGGCCCCCCAGGAGG + Intronic
1060856061 9:126915334-126915356 CCCGCCCACGGCAGCCCCGCCGG - Intronic
1061048993 9:128183096-128183118 CCAGTCCAAGGCACCCCAGGAGG + Intronic
1061119495 9:128634459-128634481 CACGAGCCTGGCAGCCCAGGAGG - Intronic
1061774082 9:132948965-132948987 CACGGCCAGGCCAGGCCAGGTGG - Intronic
1062040090 9:134400568-134400590 CCCACCCAAGGCAGCACAGACGG - Intronic
1062524404 9:136972448-136972470 AGCTCCCAAGGCAGCCCTGGGGG + Intergenic
1203793160 EBV:162272-162294 CACGGCCAAGGAGGCCAAGGTGG - Intergenic
1203665598 Un_KI270754v1:19049-19071 CACACCCCAGGCAGCCCCTGAGG + Intergenic
1203666747 Un_KI270754v1:24687-24709 CACACCCCAGGCAGCCCCTGAGG + Intergenic
1203667896 Un_KI270754v1:30326-30348 CACACCCCAGGCAGCCCCTGAGG + Intergenic
1186416718 X:9389975-9389997 CATGCCCAAGGAAGGCCAAGGGG - Intergenic
1187246044 X:17553716-17553738 CACGCCCTGGGCAGCCCATGTGG + Intronic
1189536156 X:41937189-41937211 CCAGCCAGAGGCAGCCCAGGAGG - Intergenic
1190717389 X:53115430-53115452 CAGGGCCAGGCCAGCCCAGGTGG - Intergenic
1199899493 X:152159123-152159145 CAAGCACAAGGAAGACCAGGAGG - Intergenic