ID: 1056543738

View in Genome Browser
Species Human (GRCh38)
Location 9:87595855-87595877
Sequence AGGTTGCCACGGCACCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056543738 Original CRISPR AGGTTGCCACGGCACCAACA GGG (reversed) Intronic
900492458 1:2959108-2959130 AGGTTGCCTCAGGATCAACAGGG - Intergenic
900760417 1:4466792-4466814 AGGTTGGCACTGCATCCACAGGG - Intergenic
906038131 1:42766050-42766072 AGGTTGCCACGTCGCCAGCAGGG - Intronic
906151662 1:43591308-43591330 AGGCTCCCACTGCACCAGCATGG - Exonic
911393265 1:97273269-97273291 AGTTTGCCATGGGCCCAACAAGG + Intronic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG + Intergenic
1063365583 10:5488443-5488465 AGGCTGGCAGGCCACCAACAGGG + Intergenic
1078913365 11:15754804-15754826 ACTTTACCACTGCACCAACAGGG - Intergenic
1089611481 11:119671893-119671915 ACGTTGCCACGGCACAGCCACGG + Intronic
1096579529 12:52575484-52575506 AGGTTGCAAGGGCAGCAGCAGGG + Intergenic
1097267176 12:57752642-57752664 AGGTTGCCATGGCACCGCCTCGG - Intronic
1102481535 12:113227178-113227200 AGGTAGCGAGGGCACCAAGAGGG - Intronic
1102809684 12:115813562-115813584 AGATTGCTACAGCAGCAACATGG - Intergenic
1102954265 12:117049153-117049175 AGGTTCCTACGGGAGCAACAAGG + Exonic
1104462760 12:128968914-128968936 GAGTTGCCACGGCAGCAGCAGGG - Intronic
1110541030 13:76707256-76707278 AGGTTGCACTGTCACCAACAAGG - Intergenic
1115355379 14:32441008-32441030 AGGGAGCTACGGCAGCAACAAGG + Intronic
1123038815 14:105482131-105482153 GGGTGCCCACGGCACTAACAGGG + Intergenic
1129084615 15:73075688-73075710 AGGATGCCACGTCACCAACTAGG + Intronic
1133840388 16:9402784-9402806 AGGTTGACACTGCAGAAACATGG - Intergenic
1134271816 16:12739701-12739723 AGGATGCCAAAGCAACAACATGG + Intronic
1139392303 16:66612641-66612663 AGGTTGCCAAGGCACCCGCCAGG - Exonic
1142666083 17:1464616-1464638 AGGTTGCCACAAAACCAAGATGG - Exonic
1143347770 17:6262459-6262481 AGGGTGTCAGGGCATCAACAGGG + Intergenic
1143671132 17:8396935-8396957 AGTTTCCTAAGGCACCAACAGGG - Intronic
1149786793 17:59442465-59442487 AGAGTGCAACGGCACCATCATGG - Intergenic
1154940049 18:21103507-21103529 AGAGTGCCGTGGCACCAACATGG + Intronic
1157097510 18:44699774-44699796 AGGCAGCCCCGGCTCCAACACGG - Intronic
1157492069 18:48130440-48130462 AGCTAGCCAGGGCAACAACACGG + Intronic
1164203633 19:23039882-23039904 AGGTTGCAATGGCTCCACCATGG - Intergenic
925535435 2:4911375-4911397 AGGATTTCAAGGCACCAACACGG + Intergenic
925985958 2:9214877-9214899 AGGGAGCCATGGCACAAACAAGG - Intronic
929578608 2:43068145-43068167 GGGTGGCCACGGCAGCAGCACGG + Intergenic
934731423 2:96661088-96661110 AGGTTCCCAAGGCATAAACAGGG + Intergenic
937371762 2:121303096-121303118 ATGTAGCCACTGCATCAACATGG + Intergenic
942928780 2:181464210-181464232 AGGTTGCCAAGACATCAACCAGG + Intronic
948466360 2:238153566-238153588 AGGTGGCCAGGGCACCAGGACGG + Intergenic
948602901 2:239117360-239117382 AGGTTTCCATGACACCAAAAAGG + Intronic
1168906548 20:1408465-1408487 AGGTTGTCAGGGCACCAGCATGG + Intergenic
1169610336 20:7372716-7372738 AGGTTCCCCCGGCACCTACATGG + Intergenic
1169979290 20:11365295-11365317 AGGCTGCCAAGACACAAACATGG + Intergenic
1171493401 20:25537982-25538004 CGGTATCCACGGGACCAACACGG + Intronic
1173715305 20:45198886-45198908 AGGGTGCCATGATACCAACAGGG + Intergenic
1175463398 20:59172280-59172302 AGCGTGCCACGGGAGCAACAGGG - Intergenic
1175879189 20:62246935-62246957 AGGTTGCCAGAGCACCAGGAAGG - Intronic
1176036760 20:63043381-63043403 CGGTGGCCACGGCACCTGCAAGG + Intergenic
1184461345 22:44639947-44639969 AGGGTCCCAGGCCACCAACAGGG + Intergenic
1185130527 22:49036137-49036159 AGGTTGCCACGTCACAAACAAGG + Intergenic
949944360 3:9178403-9178425 AGGTTCACACGGTACCATCAGGG - Intronic
950188444 3:10959892-10959914 AGGCTGCCATGGTAGCAACAGGG - Intergenic
954605232 3:51904373-51904395 AGGTGGCCACTGCACAAGCATGG + Intergenic
962454894 3:135556053-135556075 AGGATGCCATTGCACAAACATGG - Intergenic
963531093 3:146474312-146474334 AGATTTCCACGGCACCAAGGGGG + Intronic
964973892 3:162597083-162597105 AGTTTGCCATCGCACAAACAGGG - Intergenic
973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG + Intronic
976175036 4:82343252-82343274 AGTTTGCCTCGGCACCCTCAGGG - Intergenic
989286697 5:39707958-39707980 TCTTTGCCACGGCACCAACTTGG - Intergenic
989460814 5:41696560-41696582 AGGGTGCCAGTGCACCAAGATGG + Intergenic
1007786548 6:44283337-44283359 AGGTTGCCAGGGCAAGAACCAGG + Intronic
1008014917 6:46507974-46507996 AGGTTGCCAGAGCAACAATATGG - Intergenic
1010573738 6:77508192-77508214 AGGTGGCCAAGTCAGCAACAAGG - Intergenic
1011065305 6:83319770-83319792 ATGTTGCCAGGCCACCTACATGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028478503 7:91277802-91277824 AGGTGACCAAGGCACCAAAATGG - Intergenic
1029329688 7:99841738-99841760 ATGGTGCCACTGCACCAACCTGG - Intronic
1035561547 8:607996-608018 AGGGTGCAATGGCACCATCATGG + Intergenic
1052914623 9:33915152-33915174 AGTTGGCCAGGGGACCAACATGG + Intronic
1056543738 9:87595855-87595877 AGGTTGCCACGGCACCAACAGGG - Intronic
1057028530 9:91755767-91755789 AGGTTGCCTGGGCACCAGGAAGG - Intronic
1059358679 9:113721383-113721405 GAGTTGCCATGGCACCATCATGG + Intergenic
1060519698 9:124287261-124287283 AGGTTACCCTGGCACCAGCAGGG + Intronic
1061163769 9:128910938-128910960 AGGTGCCCACGAAACCAACAGGG - Intronic
1185651097 X:1648709-1648731 ATGTTGCCATGGCCCCAAGAGGG - Intergenic
1190649808 X:52557735-52557757 AGTTGGCCAAGGCCCCAACATGG + Intergenic
1197948134 X:131862858-131862880 AGCTTGACCCTGCACCAACATGG - Intergenic
1198867669 X:141141933-141141955 AGGTTGCCAGAGTACCAGCATGG + Intergenic