ID: 1056543983

View in Genome Browser
Species Human (GRCh38)
Location 9:87597811-87597833
Sequence CAGTGTGAGCAGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 1, 1: 0, 2: 17, 3: 184, 4: 1011}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056543983_1056543986 -10 Left 1056543983 9:87597811-87597833 CCTTCCTGCCTCTGCTCACACTG 0: 1
1: 0
2: 17
3: 184
4: 1011
Right 1056543986 9:87597824-87597846 GCTCACACTGTTCCTCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056543983 Original CRISPR CAGTGTGAGCAGAGGCAGGA AGG (reversed) Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900818275 1:4867053-4867075 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
900983559 1:6060148-6060170 TCCTGAGAGCAGAGGCAGGAGGG - Intronic
901024685 1:6272911-6272933 CAGAGTGAGCACTGCCAGGAGGG - Intronic
901446840 1:9313676-9313698 TCGAGTGAGCACAGGCAGGAAGG + Intronic
901646513 1:10719714-10719736 CAGTGAGAGAAGAGGCAGCAGGG + Intronic
901840349 1:11950283-11950305 CAGTGAGGGCACAGACAGGAGGG - Intronic
901946356 1:12707118-12707140 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
902051966 1:13570892-13570914 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902382116 1:16057669-16057691 CTGTGTGAGCATTGGCAGTAGGG + Intergenic
902689627 1:18102173-18102195 GAGTGAGAGCAGGGGAAGGAGGG + Intergenic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902783932 1:18721100-18721122 GAGTGGGAGAAGAGGCTGGAGGG - Intronic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904281025 1:29418319-29418341 CAGAGTGAGATGAGGCAGGTGGG - Intergenic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904965510 1:34369539-34369561 GAGTGGGGGCAGAGGCAGAAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907005677 1:50910846-50910868 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
908506258 1:64804001-64804023 CAGTGAGTTGAGAGGCAGGAGGG - Intronic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
910808094 1:91208507-91208529 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910852974 1:91666627-91666649 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912816005 1:112829222-112829244 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912980431 1:114366134-114366156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915657640 1:157375020-157375042 TAGGGTGGGCAGATGCAGGAGGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916443097 1:164846713-164846735 CAGTTGGGGCAGGGGCAGGAGGG + Exonic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916607284 1:166355466-166355488 CAGAGTGAGCAGCGGCAGATGGG + Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
918099918 1:181364466-181364488 CACTGTGATCAGAGGTGGGATGG + Intergenic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920339697 1:205268079-205268101 AGGTGTCAGCAGAGGCAGGGTGG + Intronic
920723234 1:208409690-208409712 GAGTGTGAGGAGGTGCAGGAGGG + Intergenic
920781047 1:208991599-208991621 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921074624 1:211690402-211690424 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
921412615 1:214851768-214851790 CAGCGTGATGAAAGGCAGGAAGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922504805 1:226120363-226120385 CAGGGTGAGCTGAGGCTGGTGGG + Intergenic
922680790 1:227593558-227593580 CAGTCTGAGGAGGGTCAGGAGGG + Intronic
922690136 1:227682546-227682568 CAGTCTGAGGAGGGTCAGGAGGG - Intergenic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922973306 1:229761244-229761266 CAGACTGAGCAGAGGAAGCAGGG - Intergenic
923000948 1:230005975-230005997 CAGTGTTATCCCAGGCAGGATGG - Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
923863635 1:237916985-237917007 AAGAGTGAGGAGAGACAGGAGGG - Intergenic
924700737 1:246449463-246449485 CAGTGTGATATGGGGCAGGAGGG + Intronic
924735247 1:246749803-246749825 CAGTCTGAGGAGAGCTAGGAAGG + Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062799088 10:366437-366459 CAGTGTGAGAGGGGGCAGGTGGG + Intronic
1062867170 10:865512-865534 CAGTGTGCCCAGAGACAGCAAGG - Intronic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063472605 10:6300251-6300273 CCTTGTGGGCAAAGGCAGGAAGG - Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064602796 10:17010208-17010230 CAGTGTGAAAAGAGACAGAAAGG - Intronic
1064756497 10:18576318-18576340 TAGTCTGAGGAGAGCCAGGAGGG - Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065297818 10:24293414-24293436 CAGTGCCTGCAGAGGCAGCAAGG - Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066176415 10:32912318-32912340 GAGTGTGAGCCGAAGCAGGGCGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067133413 10:43586778-43586800 CTGTGTTAGCAGAGACAAGAAGG - Intergenic
1067236463 10:44454496-44454518 GAGTGTGAGCCAAAGCAGGATGG - Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068478008 10:57552244-57552266 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068671813 10:59730648-59730670 CAGTCTGAGGAGAGTCATGAGGG + Intronic
1068675816 10:59768215-59768237 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1068681742 10:59827458-59827480 GAGTGTGAGGACAGGCAGGAAGG + Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069939229 10:71943025-71943047 CAGTCTGAGGACAGTCAGGAGGG - Intergenic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070327724 10:75399380-75399402 CAGTGGTAGCTGAGGCAGTAAGG + Exonic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070734725 10:78855616-78855638 CAGTGGGAGATGAGGCAGGCAGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1070987878 10:80703650-80703672 CAGTGTGGTGAGAGACAGGATGG + Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1072334787 10:94388416-94388438 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075071137 10:119320691-119320713 CCCTGAGAGCAGAGGCAGGGAGG + Intronic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076671002 10:132121097-132121119 CAGTCAGAGAAGAGGCAGGCTGG + Intronic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077178033 11:1199416-1199438 CAGTGTGAGAAGCACCAGGATGG + Intronic
1077246334 11:1541026-1541048 CAGTGTGAAGAGACACAGGAAGG + Intergenic
1077337022 11:2009941-2009963 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1077379194 11:2220761-2220783 CAGTGTGTGCAGAGACCGTATGG + Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1079170710 11:18092639-18092661 AAGTATCAGCAAAGGCAGGAAGG + Intronic
1079463742 11:20708309-20708331 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1079893045 11:26082131-26082153 TAGTGTGAGCAGTGTAAGGATGG - Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080883546 11:36345091-36345113 GGGTGAGAGCAGCGGCAGGAAGG + Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1081587453 11:44397130-44397152 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1081729140 11:45356255-45356277 CCTAGTGAGCAGAGCCAGGAAGG + Intergenic
1082791081 11:57347242-57347264 GAGTGGGAGCAGTGGCAGGGAGG + Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083082214 11:60105544-60105566 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1083089876 11:60189000-60189022 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1083256418 11:61498810-61498832 CGGTGTGAGGAGCGGCAGCAGGG - Intergenic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083594824 11:63914174-63914196 CAGTGAAAGGAGAGGCAGGTAGG + Intronic
1083681341 11:64353232-64353254 CAGTGTGAGGTGTGGCTGGAGGG + Exonic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084785086 11:71437532-71437554 CAGTGCGGGCACTGGCAGGAGGG - Intronic
1084938990 11:72602318-72602340 CAGTGTGGGGAGAGACAGGGTGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085239770 11:75043624-75043646 TAGTCTGAGCAGAGTCAGGAGGG - Intergenic
1085472691 11:76768357-76768379 CCGAGTGTGCAAAGGCAGGAAGG - Intergenic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1086923878 11:92618445-92618467 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1086973476 11:93107689-93107711 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1086987553 11:93266827-93266849 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087684501 11:101248109-101248131 CAGTCTGAGTAGAGTCAGGAGGG - Intergenic
1087894792 11:103575606-103575628 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088132309 11:106508161-106508183 CAGTGTTTGCTGAGGCAGCAGGG - Intergenic
1089495928 11:118908727-118908749 CATTGTTAGGGGAGGCAGGATGG - Intronic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1089969258 11:122679226-122679248 CAGTGCGTGCATAGGCACGATGG + Intronic
1090157591 11:124458082-124458104 CAGTGGGACCAGAGTCCGGAGGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090304719 11:125681391-125681413 CAGTGTCAACTGTGGCAGGAAGG - Intergenic
1090589009 11:128245373-128245395 GCGTGTGAGCAGAGGAAGTATGG - Intergenic
1090731859 11:129579436-129579458 CAGTGTGAGCAGTGTCTGCAAGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090876846 11:130797875-130797897 AAGTATGAGGAGAGACAGGAGGG + Intergenic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1202820006 11_KI270721v1_random:65123-65145 CAGTGGGATCTGAGCCAGGAAGG + Intergenic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1091814531 12:3426525-3426547 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1091824119 12:3497252-3497274 TAGAGTGAGCACAGGCAAGAAGG + Intronic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1092890972 12:12969024-12969046 CAGTGTGAGTGAAGGCATGAAGG + Intergenic
1093594130 12:20941218-20941240 CAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093757162 12:22865713-22865735 CAGCGTGAGCAGGGTTAGGAGGG - Intergenic
1094069416 12:26396491-26396513 TGGTGTGAGGAGAAGCAGGAAGG - Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1095162369 12:38933279-38933301 CAGTCTGAGTAGAGCCAGGAAGG + Intergenic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095621505 12:44260814-44260836 CAGTGAGAGGAGAGGCAGATGGG + Intronic
1095709794 12:45276061-45276083 CACAGAGCGCAGAGGCAGGATGG - Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096105410 12:48994788-48994810 GAGTGGGAGCAGAGGCGGGCAGG + Intergenic
1096137529 12:49214929-49214951 AAGTGTTAGCTGAGGAAGGAAGG - Intronic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1097090383 12:56499982-56500004 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098248377 12:68543781-68543803 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1100093737 12:91005989-91006011 AGATGGGAGCAGAGGCAGGAAGG - Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1102086936 12:110149681-110149703 CAGTGGGAGAAGAGTCAGGGTGG - Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1102492375 12:113297070-113297092 TGGTGTGAGCAGAGCCAGGGAGG - Exonic
1102596577 12:113997350-113997372 CAGTGTGAGATGAAGCTGGAAGG + Intergenic
1102606369 12:114070837-114070859 CAGTCTGAGGAGAGCAAGGAGGG - Intergenic
1102780700 12:115562167-115562189 CAATGTCAGCACAGGCAGGCAGG + Intergenic
1102933880 12:116881359-116881381 CAGCGGGCGCAGAGGCCGGAGGG - Exonic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103614425 12:122143164-122143186 GAGGGTGAGGAGAGGCAGGGAGG - Exonic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104483701 12:129130695-129130717 CAGTGAGAGGAGAGACAGGGTGG + Intronic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1105602976 13:21903379-21903401 CAGTATGTGCAGAGGCCGGGGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108251766 13:48574610-48574632 CAGTGGGAGCTGTGACAGGAAGG + Intergenic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109909515 13:68891066-68891088 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1110324549 13:74199015-74199037 CAGTGAGAGCCGAGGTGGGATGG + Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112080118 13:95959813-95959835 CAGTGTTAGCAGGTGCAGGGAGG - Intronic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113488058 13:110669736-110669758 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114146099 14:19979950-19979972 CAGTCTGAGAAAAGCCAGGAAGG - Intergenic
1114223514 14:20717883-20717905 CAGTCTGAGGAGAGCCGGGAAGG + Intergenic
1114236106 14:20825016-20825038 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114482441 14:23044188-23044210 GAGTGGGAGCAGGGACAGGAGGG - Exonic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115211346 14:30970228-30970250 CATTCTGAGGAGAGTCAGGAGGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115982191 14:39065643-39065665 CAGTGTGAGGAGAGGCATAGAGG - Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116634410 14:47377388-47377410 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117489136 14:56228775-56228797 GAGTGTGAGCTGAGGCAGGGTGG + Intronic
1117511329 14:56454612-56454634 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1117675638 14:58152284-58152306 CAGTGCCAGCAGAGCCAGGGCGG - Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117955210 14:61117540-61117562 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1118005928 14:61564136-61564158 CAGAGTCAGCACATGCAGGAGGG - Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118847097 14:69555644-69555666 CAGGGTGAGATGGGGCAGGAGGG + Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119164503 14:72480899-72480921 AATAGTGAGGAGAGGCAGGAGGG + Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119767686 14:77200628-77200650 CAGGGGCAGCAGAGCCAGGATGG - Intronic
1119918672 14:78426181-78426203 AAATGAGAGCAGAGGCTGGAGGG + Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1120740726 14:88106138-88106160 CAGTGGGAGCAGCTGCAGGCAGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121117413 14:91353419-91353441 CAGTCTGGGTTGAGGCAGGAAGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1121730317 14:96182229-96182251 CAGTGTGAGAAGGGGCAGTCAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122382802 14:101321679-101321701 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122817551 14:104321014-104321036 CCGTCTGAGCAGGGTCAGGAGGG + Intergenic
1122914593 14:104852426-104852448 CAGGGTGAGCCTAGGAAGGAAGG - Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124059537 15:26276823-26276845 AGGTGTGAGTAGACGCAGGAAGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124934453 15:34157041-34157063 CAGTCTGAGAAGAGCTAGGAAGG + Intronic
1125182779 15:36896421-36896443 CAGTGTCAGTAGAGTCAGGGTGG + Intronic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1125690305 15:41590905-41590927 CAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1126316189 15:47372528-47372550 CATTTGCAGCAGAGGCAGGAAGG - Intronic
1126389971 15:48137386-48137408 CAGTATGTGCATAGGAAGGAAGG + Exonic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1128554084 15:68618503-68618525 CAGTGTGATCAAAGGCTGGGAGG + Intronic
1128796400 15:70469784-70469806 CAGTGTGTGCAAAGGCACAAAGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129688743 15:77701264-77701286 CACTGAGAGGAGAGCCAGGAAGG - Intronic
1129700950 15:77768497-77768519 CATTGTGAGGAGAGCCATGAAGG + Intronic
1129927935 15:79382765-79382787 CAGGATGAGGAGTGGCAGGAAGG - Intronic
1130398663 15:83529254-83529276 CAGTGTTAGCAGATCCAGGCAGG + Intronic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1131830350 15:96351007-96351029 AAGTGTGTGCAGGGACAGGAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1132883356 16:2171932-2171954 CAGAGTGCGGAGAGGCAGGCAGG - Intronic
1133018732 16:2956579-2956601 CAGCGTGGGCAGAGCCAGGGAGG - Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133502609 16:6379975-6379997 GAGAGAGAGCAGATGCAGGAAGG + Intronic
1133617457 16:7491411-7491433 CATTGTGAGCAGAAGCAGCCTGG + Intronic
1134541668 16:15071960-15071982 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135359652 16:21801552-21801574 CAGTGTGTCCAGAGACCGGAAGG - Intergenic
1135437118 16:22436527-22436549 CAGTGTGTCCAGAGACCGGAAGG - Intronic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136263144 16:29095400-29095422 CAGTGTGTCCAGAGACCGGAAGG + Intergenic
1136785571 16:32932173-32932195 CAGCGTGAGGAGAGGTAGAAGGG + Intergenic
1137041614 16:35617786-35617808 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138487423 16:57355573-57355595 CAGTGTGGGTAGAGACAGAATGG - Intergenic
1138660030 16:58511401-58511423 CACTGTGGACAGAGACAGGATGG - Exonic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139451256 16:67029477-67029499 GAGTGTGAGGTGAGGCAGGCGGG + Exonic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141380858 16:83575496-83575518 TGGTGTGAGCAGGGGCTGGATGG - Intronic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1141685125 16:85565790-85565812 AGGTGTGAGAAGAAGCAGGAGGG + Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142540477 17:654926-654948 CAGTGAGAGCAGCGGCCAGAGGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143786338 17:9258572-9258594 GGGTGTGATCAGAGGCAGGTAGG - Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144699188 17:17325712-17325734 CAGTGGGTGGAGAGGCAGGCAGG - Intronic
1144705287 17:17363910-17363932 CAGAGTGAGCACCTGCAGGATGG + Intergenic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144727830 17:17510801-17510823 CAGCGTAAGGAGAGCCAGGATGG - Intronic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1145414701 17:22704727-22704749 TACTGTGTGAAGAGGCAGGATGG + Intergenic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146272712 17:31494944-31494966 CAGTGTGAGCAGCCTCTGGAAGG - Intronic
1146311984 17:31776396-31776418 TAGTGTGATCAGAGGATGGAAGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146764143 17:35504179-35504201 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1146847990 17:36196704-36196726 GAGTGTCAGCAGAGCCAAGAAGG + Exonic
1147145898 17:38484319-38484341 CAGCGTGAGGAGAGGCGGAAGGG + Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147810324 17:43164376-43164398 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1147837877 17:43347910-43347932 GAGGGTGAGGAAAGGCAGGAGGG + Intergenic
1148125273 17:45233449-45233471 CAGTCAGAGCATGGGCAGGAAGG - Intronic
1148204215 17:45769392-45769414 CATTGTGAGCAAAGGCCGGGAGG - Intergenic
1148828981 17:50416888-50416910 CAGTCTGAGGGGAGTCAGGAGGG + Intergenic
1148980160 17:51566756-51566778 CAGTGTGGACGAAGGCAGGAAGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149289801 17:55207029-55207051 CACTGTGAGAAGTTGCAGGAGGG - Intergenic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1150727936 17:67666652-67666674 GAGATTGAGAAGAGGCAGGAGGG + Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151502442 17:74499985-74500007 GAGAGTGATGAGAGGCAGGAAGG + Intergenic
1151561274 17:74871128-74871150 CAGCGTGAGCCGAGGCAGGTGGG - Intronic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152454930 17:80409319-80409341 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1153402340 18:4694879-4694901 GAGTGTGAGCTGAGGCAGGGCGG + Intergenic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1153830371 18:8917220-8917242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154014151 18:10601575-10601597 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1154463222 18:14617523-14617545 CAGTCTGAGAAGAGCCGGGAAGG - Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155421080 18:25657011-25657033 AAGTGTGGGCAGAGACAGGCTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156247647 18:35317646-35317668 CAGAGTGGGCAGATGCAGTAAGG - Intergenic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1158886135 18:61829210-61829232 CACTGTAAGGGGAGGCAGGAAGG + Intronic
1159570421 18:70105462-70105484 GACTGTGAGCAGAAGCAGGGCGG - Intronic
1160493234 18:79355090-79355112 CAGTGTCGGCAGAGGCCGCATGG + Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1161945755 19:7435501-7435523 CAGGGTGAGCAGGTTCAGGATGG + Intronic
1162267829 19:9590272-9590294 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
1162281882 19:9705356-9705378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162782041 19:13011525-13011547 GGGTGGGAGCAGAGGCAGGGGGG + Intronic
1163040275 19:14597010-14597032 AAGTGTGAGTAGGGCCAGGAAGG + Exonic
1163233471 19:16018601-16018623 CAGTGTGAGCAGGTACAGGTCGG + Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163867105 19:19782665-19782687 CAGTCTGAGGAGAGTCAGGGGGG + Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1163991832 19:21006199-21006221 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1164084479 19:21888796-21888818 AAGAGTGAGGAGAGACAGGAGGG + Intergenic
1164091494 19:21956802-21956824 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1164121585 19:22270033-22270055 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164130739 19:22358964-22358986 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1164216972 19:23159055-23159077 CAGACTGAGGAGAGTCAGGAGGG + Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164853596 19:31503839-31503861 CAGAGAGAGAAAAGGCAGGAGGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166939343 19:46353393-46353415 CAGTGAGAGCTGAGGCAGCTGGG - Intronic
1167054655 19:47102081-47102103 CAATGTGAGGAGAGGCTGCAAGG + Intronic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925800700 2:7597501-7597523 CAAAGTGAGCAGTGGCAGGCAGG + Intergenic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926491474 2:13530134-13530156 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
928121144 2:28584339-28584361 TGCTGTGAGCAGAGACAGGATGG + Intronic
928370334 2:30735906-30735928 CAGGGAGGGGAGAGGCAGGAGGG + Intronic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928855775 2:35801023-35801045 CAGTGTAAGAAAAGGCAGCAAGG - Intergenic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929249116 2:39733197-39733219 AAGTGGGAGCAGATGCTGGAAGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929782756 2:44967854-44967876 CAGTGTGAGTGCAGGCAGCATGG + Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931146714 2:59527253-59527275 CAGAGTGAGCAGGGACAGGGTGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
932029769 2:68171810-68171832 GATTGTGAGCAGAGGAAGGGAGG + Intronic
932662717 2:73670467-73670489 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
933389486 2:81652178-81652200 CAGTCTGAGGAGAGCCAGGAGGG + Intergenic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935048394 2:99502485-99502507 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935721502 2:105983283-105983305 TAGTCTGAGGAGAGTCAGGAGGG + Intergenic
935944234 2:108271191-108271213 CAGTGTGTGGTGAGGCAGGCTGG + Intergenic
935958721 2:108403000-108403022 CAGTCTGAGGAGAGCTAGGAAGG - Intergenic
935970566 2:108527279-108527301 CAGTCTGAGGAGAGTCAGGCGGG - Intergenic
936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG + Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937302295 2:120850671-120850693 CAGTCAGAGCAGAGGCTTGAGGG + Intronic
937543680 2:122989300-122989322 CAGGGGGAGCTGAGGCAGCAGGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
937956895 2:127426711-127426733 CAGTGGGACCACAGCCAGGACGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938673818 2:133610533-133610555 CAGGTTTAGCACAGGCAGGAGGG - Intergenic
938703145 2:133897329-133897351 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940203209 2:151174182-151174204 CAGTGAGAGCTGAGGCCTGACGG - Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940328683 2:152452331-152452353 AAATGCTAGCAGAGGCAGGAAGG - Intronic
940352806 2:152707638-152707660 CAGTCTGAGCAGAGCCAGGAAGG - Intronic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941260667 2:163292733-163292755 CAGTTTGAGCTGAGTCAGGAGGG + Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943408071 2:187513942-187513964 CAGTCTGAGGAGAGTCAGGAAGG - Intronic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945289724 2:208115356-208115378 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945720272 2:213410380-213410402 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
945971154 2:216233584-216233606 CAGTGTGAGCAGGTTCAGGCAGG + Intergenic
946170371 2:217891796-217891818 CACTGAGAGAAGAGGAAGGATGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946434144 2:219640886-219640908 CACCGTGAGCAGCAGCAGGAAGG - Exonic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947926591 2:233927048-233927070 CAGTGTCAGCAAAGCCAGGCAGG - Intronic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
948223827 2:236293501-236293523 AGGTGTGAGCAGAGGCTGGGAGG - Intergenic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948887636 2:240892126-240892148 CAGAGTGAGCAGGCTCAGGAAGG - Intronic
1168822725 20:786544-786566 CAGTCTGAGGAGAGCCAGGAAGG + Intergenic
1168824183 20:798241-798263 TAGTCTGAGGAGAGCCAGGAGGG - Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169279571 20:4255490-4255512 CTATGTCAGCAGAGGCTGGAGGG + Intergenic
1169659113 20:7958509-7958531 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1169820909 20:9708925-9708947 GGATGTGAGCAGAGGAAGGAAGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171060775 20:21957082-21957104 CAGTGTCAGCAGCTGTAGGAAGG + Intergenic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1172127981 20:32636588-32636610 CAGTGAGCGATGAGGCAGGAAGG - Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172626507 20:36350430-36350452 GAGTGTCAGCGGAGTCAGGATGG - Intronic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174574343 20:51526071-51526093 CGGGCTGAGCAGATGCAGGAAGG - Intronic
1174820633 20:53723908-53723930 CAGAGTGAGCAGAGGTAGCCTGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175344966 20:58266257-58266279 AAGTGCGGGCAGAGGCAGGGAGG + Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175513892 20:59555753-59555775 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1176811299 21:13540850-13540872 CAGTCTGAGAAGAGCCAGGAAGG + Intergenic
1177252516 21:18612827-18612849 CTATGTGAGCAGAGTCAAGATGG - Intergenic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178827397 21:36028337-36028359 CTCTGTGGGCAGAGCCAGGATGG + Intergenic
1178916063 21:36706161-36706183 CAGTGTGAGGAACGGCAGGCAGG + Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179344143 21:40540436-40540458 CAGTGTGAGGAGGGGCATGGAGG - Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1179670902 21:42946931-42946953 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181090755 22:20470953-20470975 CAGTGAGGGGACAGGCAGGAAGG + Intronic
1181148040 22:20862645-20862667 CAGTGAGAGCTGAGGCAGAGTGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1183004963 22:34893656-34893678 CAGAGTGTGCACAGCCAGGAAGG + Intergenic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183214303 22:36469163-36469185 CAGTGTTCTCAGATGCAGGATGG + Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183347671 22:37316999-37317021 CAGAGTGAGGAGTGGCAGAATGG - Intergenic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1183554303 22:38513244-38513266 CAGGGGGAGCAGGGGCAGCAGGG - Intergenic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1185104028 22:48857346-48857368 CACTGTAGGAAGAGGCAGGAAGG - Intergenic
1185109944 22:48895198-48895220 CCGTGTGTGCAGATGCAGCAAGG + Intergenic
1185345616 22:50309354-50309376 CAGTCAGTGAAGAGGCAGGAAGG - Exonic
949243958 3:1903423-1903445 TAGTGTGAGGAGAGACAGGGAGG + Intergenic
949309052 3:2675211-2675233 TAAGGTGAGGAGAGGCAGGAAGG - Intronic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949609906 3:5693349-5693371 CAGTCTGAGGAGAGCTAGGAAGG + Intergenic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950227755 3:11249834-11249856 CAGTCTGAGGAGAGCCAGGAAGG + Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950428047 3:12935210-12935232 CAGGCTGAGCAGGGGCAGAATGG - Intronic
950790815 3:15470461-15470483 CAGTGTGTGGAGTGGCAGGCAGG - Intronic
950846158 3:16017853-16017875 CAGTTTGAGGAGAGCCAGGAGGG + Intergenic
950857001 3:16115151-16115173 TGGCGTGAGCTGAGGCAGGAGGG + Intergenic
950968358 3:17162322-17162344 CACTGTGTGCAGAGCCAAGAAGG + Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951144095 3:19205765-19205787 AAGTATGAGCAGAGGCATAAAGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951248570 3:20368156-20368178 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951485418 3:23203694-23203716 CAGGGAGAGAAGAGGCAGAAGGG - Intronic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953187215 3:40649288-40649310 TAGTGAGAGCAGAGGCTGCAAGG - Intergenic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953903857 3:46858490-46858512 CCGTGCGTGCAGAGGCATGATGG + Intronic
953953322 3:47210118-47210140 GAGAGTGAGCAGAGACAGTATGG - Intergenic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954169315 3:48787941-48787963 CAGAATGTGCAGAGACAGGAAGG - Intronic
954400408 3:50316744-50316766 TGCTGTGGGCAGAGGCAGGAGGG - Intergenic
954604723 3:51900530-51900552 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
957999938 3:87737748-87737770 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960720372 3:120619286-120619308 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
960733445 3:120751226-120751248 TGGGGTGGGCAGAGGCAGGAGGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961329703 3:126131341-126131363 CAGTGTGAGCACATGCAGACTGG - Intronic
961520437 3:127464602-127464624 GAGTGTGTGCCAAGGCAGGATGG + Intergenic
961558794 3:127714733-127714755 GAGTGTGCAAAGAGGCAGGAGGG + Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962097360 3:132306220-132306242 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962277050 3:134023441-134023463 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964473081 3:157074719-157074741 TATTGTGAGCATAAGCAGGAGGG - Intergenic
964933033 3:162048700-162048722 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
966999324 3:185316859-185316881 CATTGTGAGCTTGGGCAGGAAGG + Intronic
967007752 3:185400243-185400265 CAGGGTGCGCAGACGCAGGGAGG - Intronic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
970148203 4:13059193-13059215 CAGTGACAGGAGAGTCAGGAGGG - Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970864060 4:20738765-20738787 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
972075337 4:35079764-35079786 TGGTGCCAGCAGAGGCAGGAGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972331833 4:38071160-38071182 CAGTAAGAGCAGGGACAGGAGGG - Intronic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972784969 4:42318309-42318331 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975205632 4:71641802-71641824 CAGTCTGAGGAGAGTCAAGAGGG - Intergenic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975669244 4:76763618-76763640 CAGTGGGAGATGAGGCTGGAAGG + Intronic
975752472 4:77538191-77538213 CAATGAGAGAGGAGGCAGGAAGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
977043586 4:92042582-92042604 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
977972361 4:103227261-103227283 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978314163 4:107417597-107417619 TAGTCTGAGGAGAGTCAGGAGGG - Intergenic
978557727 4:109998708-109998730 CATAGTGAGAAGAGGCAGCATGG - Intronic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980438811 4:132814914-132814936 CAGTCTGAGGAGAGTCAGGATGG + Intergenic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981501564 4:145457684-145457706 AAGTGTGAGCGGAAGCAGGGCGG + Intergenic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
981921019 4:150084852-150084874 CAGTGGTAGCATGGGCAGGAAGG - Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
982219624 4:153113424-153113446 CAGTCTGAGCTGAGTAAGGAGGG - Intergenic
982595856 4:157382015-157382037 CAGTGTGGGCAGAGGCCCTAAGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983560170 4:169093016-169093038 TAGTATCACCAGAGGCAGGAAGG - Intergenic
983708420 4:170686649-170686671 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
983897953 4:173102063-173102085 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
984908886 4:184653338-184653360 TAGTGGGAGAAGAGGCAGCAGGG - Intronic
984943487 4:184953648-184953670 CAGCGTGAGAAGAGGAAGAATGG + Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985473830 5:66099-66121 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985620672 5:953165-953187 CGGGGTGGGAAGAGGCAGGAGGG + Intergenic
985877765 5:2613251-2613273 CCCTGGGAGCCGAGGCAGGAGGG - Intergenic
986188583 5:5470316-5470338 AAGTGAGAGCAGAAGCAGGCTGG - Intronic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
987112180 5:14698745-14698767 CATTGTGAGCAGAGGAATCAAGG + Exonic
987711412 5:21503720-21503742 CAGTGTCAGTAGAGTCAGCATGG - Intergenic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988673410 5:33406528-33406550 CAGTGTGCTCAGAGGCAGTCAGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
991306063 5:65177450-65177472 CAGTCTGAGAAGAGTCAGGAGGG - Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
991761775 5:69922837-69922859 CAGTGTCAGTAGAGTCAGCATGG - Intergenic
991785554 5:70195263-70195285 CAGTGTCAGTAGAGTCAGCATGG + Intergenic
991841003 5:70797886-70797908 CAGTGTCAGTAGAGTCAGCATGG - Intergenic
991877999 5:71195653-71195675 CAGTGTCAGTAGAGTCAGCATGG + Intergenic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995617043 5:113976459-113976481 CTGTTAGAGCAGAGCCAGGATGG + Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
995867408 5:116706532-116706554 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
996091893 5:119359383-119359405 CAGTGTGGGGAGAGCCAGCAAGG - Intronic
996318249 5:122185552-122185574 GAGTGTGAAAGGAGGCAGGAGGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997606950 5:135182037-135182059 CAGTATGAGCTGAGACAAGAAGG + Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998279203 5:140788413-140788435 CAGTGTGAGCACCAGCAGGCTGG - Exonic
998392673 5:141797425-141797447 GGGTGTGAGAAGAAGCAGGAGGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998914657 5:147000834-147000856 CAGTGTGAACCTAGTCAGGAGGG - Intronic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000121012 5:158197917-158197939 CAGGGTGAGAAGAGGCAGAGCGG + Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000236810 5:159369685-159369707 CAGTCTGAGGAGAGTCAGGAAGG - Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002045569 5:176539920-176539942 TAGCCTGAGCAAAGGCAGGAAGG - Intergenic
1002104976 5:176875537-176875559 CCGTGTCAGGAGAGGCAGCAAGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1002999132 6:2314572-2314594 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003135008 6:3428254-3428276 GAGGGTGAGGAGGGGCAGGAAGG - Intronic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005461922 6:26077563-26077585 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007836320 6:44676691-44676713 CTGAGTCTGCAGAGGCAGGAGGG + Intergenic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008123454 6:47643992-47644014 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1008474647 6:51922912-51922934 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009635754 6:66262520-66262542 CAGTCTGAGGAAAGTCAGGAAGG - Intergenic
1010405921 6:75505681-75505703 CAGTCTGATCAGTTGCAGGAGGG + Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011570368 6:88728322-88728344 CAGTCTGACGAGAGTCAGGAGGG - Intronic
1011598081 6:89035407-89035429 AAATGTGAGCTGAGACAGGAAGG + Intergenic
1011706129 6:90003234-90003256 CAGAGTGAGCCAAGGCAGGGTGG - Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015231593 6:130921184-130921206 GACTGAGACCAGAGGCAGGAAGG - Intronic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1015825739 6:137309576-137309598 GAGTGTGCTCAGAGTCAGGAGGG + Intergenic
1015998109 6:139015163-139015185 CAATCAGAGCAAAGGCAGGAAGG + Intergenic
1016479516 6:144467122-144467144 CACTGTGAGCTGAGTCAGGTGGG + Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017256578 6:152340282-152340304 AGGTGTGAGCAGAGGTCGGAGGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018493846 6:164327246-164327268 CCTTGTGAGCAGAGTCACGATGG + Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019420343 7:947904-947926 CAGTGTGCCCAGAGCCAGGGCGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1020043911 7:5025353-5025375 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020655767 7:10926717-10926739 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1020809947 7:12839653-12839675 GAGAGTGAGCCGAGGCAGGGCGG + Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1021202831 7:17744392-17744414 CAGTGTGAGAACAGACAGGGGGG + Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1021848010 7:24781172-24781194 CAGTGTGACCACAGACAGGCAGG + Intergenic
1021849371 7:24792425-24792447 TAGTCTGAGAAGAGTCAGGAGGG + Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022451582 7:30520811-30520833 CAGAGTGGAGAGAGGCAGGAAGG + Intronic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1022909327 7:34884878-34884900 CAGTGAGGGCACAGGCAGGAAGG - Intergenic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023799091 7:43817976-43817998 CAGTCTGAGGAGAGTAAGGAGGG - Intergenic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024037123 7:45516633-45516655 CAGTGTCAGAAGTGGTAGGAAGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024812927 7:53234896-53234918 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1026364331 7:69632542-69632564 GAGGGAGAGGAGAGGCAGGATGG - Intronic
1026993417 7:74600792-74600814 CGGTGTTAGCAAAGGCAGGCAGG + Intronic
1027190496 7:75993474-75993496 CAGTGTGAGGAGAGCCAAGCAGG + Intronic
1027226472 7:76247061-76247083 CAGTGTGGACACAGGCTGGAGGG + Intronic
1028333967 7:89628680-89628702 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1029506045 7:100964840-100964862 CAGAGTGAGCCCAGGCTGGAGGG + Exonic
1029822051 7:103156073-103156095 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031922454 7:127612056-127612078 GAGTGTGGTGAGAGGCAGGAAGG + Intronic
1032170537 7:129581046-129581068 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032901925 7:136320358-136320380 CAGTGTTAGCAGATCCAGGCAGG + Intergenic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1033631900 7:143166495-143166517 CAGTGTGACCAAAGAAAGGAAGG - Intergenic
1034015939 7:147586512-147586534 CAGAGAGAGAAGAGGAAGGAAGG + Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035006271 7:155663458-155663480 GAGGGTGAGCAGAGGCGGGGAGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036009758 8:4708898-4708920 CAATGTGAGCAAATACAGGAAGG + Intronic
1036093202 8:5692073-5692095 CAGTGTGAGCACAGCCTGCACGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037033268 8:14136322-14136344 AAGTGTGAGCCGAAGCAGGGTGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037920641 8:22803085-22803107 GAGAGTGAGGAGAGGCAGGGAGG - Intronic
1038089650 8:24239134-24239156 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1038319799 8:26515263-26515285 CAGCGTGAGAAGAGCCAGGAAGG + Intronic
1039061058 8:33572501-33572523 AAGTGTCAGCAGAGGCTGGGAGG + Intergenic
1040005979 8:42621299-42621321 CAGTGTGAGAAGCTGCAGGTCGG + Intergenic
1040431785 8:47349941-47349963 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1040451759 8:47554715-47554737 AAGTGTGAGCCGAAGCAGGGTGG - Intronic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040829535 8:51661748-51661770 CAGTGTGAGGAAAGCCAGAAAGG + Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041515449 8:58694667-58694689 CAGTCTGAGAAGAGTCAGGAGGG - Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044175795 8:89120604-89120626 CAGTGTGAGGGGAGGCCTGAAGG - Intergenic
1044184602 8:89236505-89236527 CAGTCTGGGGAGAGTCAGGAGGG + Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044832128 8:96261283-96261305 CAGTGTGAGAAGCCTCAGGAGGG - Intronic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1047762295 8:127963181-127963203 CAGCCTGGGCAGGGGCAGGAAGG - Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048692519 8:136983632-136983654 CAGTTTGTGCAGACACAGGAAGG - Intergenic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049414041 8:142487380-142487402 CAGTGAGCGGAGGGGCAGGAGGG - Intronic
1049484799 8:142850104-142850126 GAGTGTGAGCCAAAGCAGGACGG + Intronic
1049495101 8:142926366-142926388 CAGACTCAGCAGGGGCAGGAAGG - Intergenic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051612858 9:18978453-18978475 GAGTTTGAGCTCAGGCAGGAAGG - Intronic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052508073 9:29380709-29380731 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1052935527 9:34089778-34089800 CAGTGTGTGGATAGGCAGGATGG - Intronic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053110758 9:35457696-35457718 CATTCTGAGGAGAGTCAGGAGGG + Intergenic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053416317 9:37949016-37949038 CAGTGTGAGGACAGGCATCATGG + Intronic
1053442931 9:38130752-38130774 CAGAGTGAGCAGTGGAATGAAGG + Intergenic
1053476841 9:38388329-38388351 CAGTGGGAGAAGAGACAGGCAGG + Intergenic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1055013907 9:71595687-71595709 GAGTGTGAGCCGAAGCAGGGCGG + Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056414437 9:86362616-86362638 CAGTCTGAGGAGAGTCAGGAAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056827350 9:89885508-89885530 CAAAGAGAGCAGGGGCAGGAAGG - Intergenic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057870897 9:98716430-98716452 CAGTGTTAGCAGAGTCAGCATGG - Intergenic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058375228 9:104315141-104315163 CAGTTTGAGCAGAGGCCCAAAGG - Intergenic
1058644874 9:107121704-107121726 CAGTCTGAGCTGAGGCAGCTTGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059990636 9:119862055-119862077 CAGTGTGGGTAGAGGCAGCTGGG - Intergenic
1060153932 9:121305946-121305968 GAGTGTGAGAAGGGGCAGGGAGG + Intronic
1060175303 9:121493232-121493254 CAGTCTGAGTAAAGCCAGGAAGG + Intergenic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061433215 9:130544333-130544355 AAGAGTGAGCAGATGCAAGAGGG - Intergenic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061511972 9:131067136-131067158 CACTGTGAGCACTGTCAGGAAGG + Exonic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061879617 9:133562267-133562289 CAGTGTGAGCAGAGCCTGCAGGG - Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1203776135 EBV:74234-74256 CAGTGTGAGCAGTTCCACGAGGG + Intergenic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1186144155 X:6608518-6608540 CAGTGTAAGCGGAGTCAGGCAGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187048072 X:15667824-15667846 CTCTGGGAGCTGAGGCAGGAGGG - Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1189034549 X:37482484-37482506 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1189178708 X:38982955-38982977 GAGAGTGAGCAAAGGAAGGAGGG + Intergenic
1189833887 X:45001514-45001536 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1189884908 X:45532777-45532799 CACTCTGAGCAGAAGCAGGAAGG - Intergenic
1190245757 X:48689063-48689085 CAAGGTGAGGACAGGCAGGATGG + Exonic
1190270251 X:48857614-48857636 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190771205 X:53516264-53516286 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191639219 X:63412530-63412552 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191917993 X:66222732-66222754 CAGTCTGAGGAGAGTCAGGAGGG + Intronic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192240242 X:69322754-69322776 TGGTGTGAGAATAGGCAGGAAGG + Intergenic
1192245088 X:69365413-69365435 AAGTGTCAGCTAAGGCAGGAAGG - Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192740943 X:73892376-73892398 GAGTATGAGCCGAAGCAGGATGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1193717315 X:84948273-84948295 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194708039 X:97200049-97200071 GAGAGTGAGCACAAGCAGGATGG + Intronic
1194739360 X:97554292-97554314 CACTGAGAGGAGAGGTAGGAGGG - Intronic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195846865 X:109238228-109238250 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196423019 X:115541848-115541870 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1196460054 X:115920360-115920382 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1196524973 X:116720844-116720866 CAGTGTGATTAGGGGCAGCATGG + Intergenic
1196869391 X:120098587-120098609 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1196944627 X:120811680-120811702 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197292490 X:124675995-124676017 CAGTGTGAGCTCAGTCAGAAAGG + Intronic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198366138 X:135941703-135941725 GAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198742457 X:139855778-139855800 CAGTCTGAGGAGAGTCAGGAGGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199278601 X:145974162-145974184 CAATCTGAGGAGAGTCAGGAGGG - Intergenic
1199608591 X:149595318-149595340 CAGGCCGAGGAGAGGCAGGAAGG - Intergenic
1199630531 X:149774042-149774064 CAGGCCGAGGAGAGGCAGGAAGG + Intergenic
1199638339 X:149835062-149835084 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200763281 Y:7059162-7059184 CGGTCTGAGGAGAGTCAGGAGGG + Intronic
1200769227 Y:7108264-7108286 CGGTCTGAGGAGAGTCAGGAGGG - Intergenic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic
1201260088 Y:12150256-12150278 CAGTCTGAGGAGAGTCAGGAGGG + Intergenic
1201308891 Y:12576729-12576751 CAGTCTGAGGAGAGTCAGGAGGG - Intergenic
1201393147 Y:13520269-13520291 GAGTGTGAGCTGAAGCAGGCAGG - Intergenic
1201479555 Y:14425066-14425088 CATTTTTAGCTGAGGCAGGAGGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic