ID: 1056545054

View in Genome Browser
Species Human (GRCh38)
Location 9:87606478-87606500
Sequence AGGGAGAGACAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26420
Summary {0: 1, 1: 36, 2: 485, 3: 4767, 4: 21131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056545054 Original CRISPR AGGGAGAGACAGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr