ID: 1056545791

View in Genome Browser
Species Human (GRCh38)
Location 9:87612358-87612380
Sequence CTCCACAGGGCCTTCTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 18, 3: 37, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056545791_1056545796 12 Left 1056545791 9:87612358-87612380 CCTTATAAGAAGGCCCTGTGGAG 0: 1
1: 1
2: 18
3: 37
4: 181
Right 1056545796 9:87612393-87612415 AGTGAAGCATCTATACGCCAAGG No data
1056545791_1056545798 30 Left 1056545791 9:87612358-87612380 CCTTATAAGAAGGCCCTGTGGAG 0: 1
1: 1
2: 18
3: 37
4: 181
Right 1056545798 9:87612411-87612433 CAAGGAACCTGCCAGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056545791 Original CRISPR CTCCACAGGGCCTTCTTATA AGG (reversed) Intronic
900982477 1:6054173-6054195 CACCACATGGCCTTCTTATAAGG - Intronic
901864732 1:12097234-12097256 CTCTCCAGGGCCTCCTTCTAGGG + Intronic
902625266 1:17672818-17672840 CCCCATAGGGCCTTCTTATGTGG + Intronic
903544094 1:24112770-24112792 CCCTGAAGGGCCTTCTTATAGGG + Intergenic
905042176 1:34968862-34968884 CTCTACAGGTCTTTCATATACGG - Intergenic
906365007 1:45201046-45201068 TTTCACATGGCCTTCTTATAAGG - Intronic
906613738 1:47221096-47221118 CTCCACAGGGCCTTGCAGTAAGG + Intronic
906667692 1:47633035-47633057 CTCCACAGGCCCCTCTTTTCTGG - Intergenic
907656666 1:56350049-56350071 CTCTTCAGGCTCTTCTTATAAGG + Intergenic
907823210 1:57990736-57990758 CTCCCCCGGGCCTGATTATATGG - Intronic
911755945 1:101557000-101557022 CTCCACATGGACTTCTCTTATGG + Intergenic
914419759 1:147518625-147518647 CACCTCAGGGTCTTCTTCTAAGG - Intergenic
915629792 1:157143816-157143838 CTCCTCATGGCTTTCTTATGAGG + Intergenic
920751658 1:208683624-208683646 TTCCTCAGGGCCTTCAGATAAGG - Intergenic
922170568 1:223151044-223151066 CTCCCCAGGGGGTGCTTATAAGG + Intergenic
922361223 1:224823262-224823284 CACCACAGAGCTTTCTTTTAGGG + Intergenic
922478440 1:225922667-225922689 CACCATAGGGCCTTCTTACCTGG - Intronic
922942677 1:229481407-229481429 GCCCACGTGGCCTTCTTATAAGG - Intronic
1064785760 10:18892650-18892672 CTTCACATGACCTTCTTACAAGG - Intergenic
1065423766 10:25577319-25577341 CTCTACAGTCCCTTCCTATATGG - Intronic
1067091642 10:43268680-43268702 CTCCACTTGGCCTCCTTCTAAGG - Intergenic
1067250525 10:44582484-44582506 CCTCACAGGGCCTGCTTACAGGG + Intergenic
1068409464 10:56636194-56636216 CTCTCCAGGCTCTTCTTATAAGG - Intergenic
1074490382 10:113934565-113934587 CCACACATGGCCTTCTTACAAGG - Intergenic
1074670649 10:115786546-115786568 CTTCATATGGCCTTCTTAGAAGG + Intronic
1075616431 10:123893413-123893435 CTCCACCAGGCCATCTTTTAGGG + Intronic
1079359097 11:19755702-19755724 CTTCACATAGCCTTGTTATAAGG + Intronic
1082081408 11:48015198-48015220 CTCCATCGGGCCTTCATAAACGG - Intronic
1083033216 11:59613484-59613506 CACCTCAGGGCCTTCGTATGTGG - Intronic
1083988692 11:66233434-66233456 ACCCTCAGGGCCTTCTTAAAAGG + Intronic
1084105775 11:66979358-66979380 CTCCACATGGCCTTCCTATCAGG - Intergenic
1084617214 11:70244547-70244569 GTTCACATGGCCCTCTTATAAGG + Intergenic
1085871832 11:80359149-80359171 CTCCACTGGGCCTATTTAAAAGG + Intergenic
1085880031 11:80455670-80455692 CTTCACATGGCCTTCTTATAAGG + Intergenic
1088292425 11:108255127-108255149 CTCCACAGTGCCTTATTACATGG + Intronic
1089074797 11:115729287-115729309 CTTTACAGGGCCCTCTTATCTGG - Intergenic
1092874132 12:12833528-12833550 CTTCACAAGGCCTTCTTAGAAGG + Intergenic
1093223062 12:16446896-16446918 CTCCTGATGGCCTTCTTAAATGG + Intronic
1094337606 12:29378156-29378178 CTTCACATGGCCTTCTTAAAAGG - Intronic
1096054357 12:48638882-48638904 CTTTACATGGCCATCTTATAAGG - Intergenic
1096131537 12:49162916-49162938 CTTCACATGGCCTTCTTATAAGG - Intergenic
1096629229 12:52915016-52915038 CTCCACAGGGTCTTGTTATGTGG - Intronic
1098651537 12:72976758-72976780 TTCCAGGGGGCCTGCTTATACGG - Intergenic
1099061898 12:77921923-77921945 CTCCAAAGGACCTTATGATATGG - Intronic
1099535533 12:83839092-83839114 CTCTATGGGGCCTTTTTATAAGG - Intergenic
1103845941 12:123902166-123902188 CTGCACATGGCCTTCTGATAGGG + Intronic
1104382056 12:128315766-128315788 CTGCACATGGCCTTCTCATAAGG - Intronic
1104674017 12:130700544-130700566 CTCCACATGGCCTTCTCCTGCGG - Intronic
1104964901 12:132504528-132504550 CTCCACCGCGCCTTCTTGGAGGG + Intronic
1106600790 13:31184831-31184853 CTCCACAGGGCCTTGCTCCAAGG + Intergenic
1107914662 13:45137188-45137210 TACCACTGGGCCTACTTATAGGG + Intronic
1107964091 13:45584268-45584290 CTCCAGAGCGTCTTCTCATATGG + Intronic
1108033448 13:46261379-46261401 CTTCACATGCCTTTCTTATAGGG - Intronic
1111473324 13:88715105-88715127 CTCTACAGTTTCTTCTTATAAGG - Intergenic
1112561041 13:100514297-100514319 CTTCACAGGGCCTACTGAAAAGG - Intronic
1115671222 14:35613698-35613720 CTTCACGTGGCTTTCTTATAAGG + Intronic
1116691156 14:48107602-48107624 CTCCACAGGGTCTTCTTCAGAGG + Intergenic
1116981813 14:51179343-51179365 CTCCACAAGCCCTTTTTATATGG + Intergenic
1118586653 14:67359767-67359789 CTCCACAGTGTCTTCCTCTACGG + Exonic
1118921261 14:70151862-70151884 CATCACATGGCCTTCTTGTAAGG + Intronic
1120800170 14:88679107-88679129 CTTCACATGGCCTTCTTATAAGG + Intronic
1121267134 14:92611553-92611575 CATCACATGGCCTTCTTATGAGG + Intronic
1121366892 14:93321293-93321315 CTCCAAAGGTGCTTCTTTTAAGG + Intronic
1121920078 14:97872347-97872369 GCCCTCAGGGACTTCTTATATGG - Intergenic
1125417613 15:39469853-39469875 CTCCACAGGGGCTACTTACATGG + Intergenic
1125830351 15:42711439-42711461 CTCCACATAGCCTTCTTATAAGG + Intronic
1125975020 15:43943611-43943633 CTCTTCATGGTCTTCTTATAAGG - Intronic
1127681682 15:61303905-61303927 CATCACATGGCCTTCTTCTAAGG + Intergenic
1128259118 15:66220056-66220078 CTTCACGTGGCCTTCTCATAAGG - Intronic
1132801824 16:1758396-1758418 CTCCGCAGGGCCTTCAGAAATGG - Intronic
1134090787 16:11390652-11390674 CTCTGCAAGGCCTGCTTATAAGG + Intronic
1135199359 16:20423521-20423543 CTCTCCAGGGGCTTCCTATAAGG + Intronic
1135602825 16:23797686-23797708 CTCCTCAGGGCCCTCTCAAATGG - Intergenic
1137411676 16:48233608-48233630 ATCCACAGGGCCTCATTCTAGGG - Intronic
1139399963 16:66673610-66673632 TTCCACAGGGCCTCTTAATATGG + Intronic
1141066633 16:80919305-80919327 CTCTACACAGACTTCTTATAGGG - Intergenic
1141159525 16:81619814-81619836 CTTCACAGGGCTGTCTTGTAAGG + Intronic
1141301021 16:82815668-82815690 CTCCACAGGGCTCTGTTATTTGG + Intronic
1144321426 17:14124779-14124801 CCCCACAAGTCCATCTTATAGGG - Intronic
1144349803 17:14384197-14384219 CTTCACAGAGCCTTCCTTTAAGG - Intergenic
1146400608 17:32497598-32497620 CTCCACAGGACCTACTGACAGGG - Intronic
1148242223 17:46007749-46007771 CTCCACATGGCTTTCTAAAAGGG - Intronic
1148586371 17:48784106-48784128 CTTTACATGGCCTTCTTATAAGG - Intronic
1148809959 17:50284003-50284025 CTCCACATGGCCTTCTCCTCAGG + Intergenic
1150334015 17:64317201-64317223 CTTCACATGGCCTTCTGAGAAGG - Intergenic
1153147504 18:2050458-2050480 CACAACAGGGTCTTCTTTTAAGG - Intergenic
1155072229 18:22326713-22326735 CTTCACGTGGCCTTCCTATAAGG - Intergenic
1155374712 18:25143712-25143734 CTCTACAGGCCCTTCTAATTGGG - Intronic
1158483373 18:57842790-57842812 CTTCATATGGCCTTCTTGTAAGG + Intergenic
1158804570 18:60954454-60954476 CTCCACAGTGCCATTTTGTAGGG - Intergenic
1163363400 19:16862298-16862320 ATCCCCAGGGCCTTCTGAGAGGG - Intronic
926752138 2:16206322-16206344 CTTCACATGGCCTTCTTATGAGG - Intergenic
926820947 2:16851205-16851227 CTTTACATGGCCTTCTTAAAGGG - Intergenic
926839291 2:17060791-17060813 CTCTGCAGGGCCATCTTATTTGG + Intergenic
927407046 2:22782510-22782532 CTCCTCAGTGTCTTCCTATAAGG - Intergenic
928083136 2:28327382-28327404 CTCCAGAGGGCCTCCTTGGAGGG + Exonic
928536180 2:32243827-32243849 CTCCAAATGGGCTTCATATAGGG + Intronic
928979762 2:37125559-37125581 CTCCACATGGCCTCCCTATGGGG - Intronic
930533688 2:52620905-52620927 CTCCACAGGGACTTTGTACAGGG - Intergenic
933848637 2:86348084-86348106 CTCCACATGGCTTTCTTATAAGG + Intergenic
939514401 2:143148529-143148551 CTGCACATGGCCATCTTAAATGG - Intronic
939872949 2:147545316-147545338 CTCCACAGGGCCTTTTCTTGTGG - Intergenic
940906294 2:159172920-159172942 CCCCACAGGGCCTCCTCACAAGG - Intronic
943465921 2:188229093-188229115 CTCCACAGAGCATGCTTATAGGG - Intergenic
944119484 2:196225785-196225807 CTTCACACGGCCCTTTTATAAGG - Exonic
944438086 2:199712816-199712838 CTTCACATTGTCTTCTTATAAGG + Intergenic
945202094 2:207292465-207292487 CTTCACATAGCCTTCTTATAAGG - Intergenic
946851981 2:223916687-223916709 CTCTACAGGGCTTTCTTTTCAGG + Intronic
947047421 2:226004431-226004453 CACCACAGTGCCTTCATATTAGG - Intergenic
947986949 2:234456361-234456383 CTTCACATGGCCTCCTTAGAAGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948854802 2:240725084-240725106 CTCCACAGAGTCTTCATCTAGGG + Intronic
1175354667 20:58355041-58355063 CTCTACAGGGCCTGCTTCTTTGG - Intronic
1177008221 21:15699867-15699889 CTCCACATGGACATCTGATATGG - Intergenic
1178483992 21:33005509-33005531 TCCCTCAGGCCCTTCTTATAAGG - Intergenic
1179227097 21:39464111-39464133 GTTCACATGGCCTTCTCATAAGG + Intronic
1179955522 21:44736149-44736171 CTCCACACGACCTTCACATAAGG + Intergenic
1180245533 21:46545009-46545031 ATACACAGCACCTTCTTATAAGG - Intronic
1180632870 22:17241839-17241861 CTCCAGAGAGCCTTCTTCCAGGG - Intergenic
1184106669 22:42371336-42371358 CTTCACATGGCCTTCTTATAGGG + Intergenic
1184470651 22:44693926-44693948 GCCCACATGGCCTTCTTATAAGG + Intronic
1184715261 22:46278363-46278385 CTTCACACGGCCCTCTTGTAAGG + Intronic
949228380 3:1720937-1720959 CTCCAAATGACCTTCTTATAGGG + Intergenic
950736142 3:15009933-15009955 TGCCACATGGTCTTCTTATAAGG + Intronic
954544988 3:51425973-51425995 CTTCACAGGACCTTCTGAAAGGG - Intronic
954861433 3:53694228-53694250 CTCCACTGGGGCTCCTTAGATGG + Intronic
958647869 3:96895847-96895869 CTTCACACAGGCTTCTTATAGGG + Intronic
958648117 3:96899284-96899306 CTTCATACAGCCTTCTTATAAGG + Intronic
958966370 3:100563244-100563266 CTTCACATGGCCTTCTTATAAGG + Intronic
959563458 3:107809496-107809518 CTCCACAGAGCCCTCATATAAGG + Intronic
959712768 3:109401441-109401463 CTTTACAGGGTCTTCTTAAAAGG + Intergenic
961655214 3:128438196-128438218 CCCCACGGGGCCTTCCTTTATGG + Intergenic
962301232 3:134244892-134244914 CTCCCCTGGGTCTTTTTATAAGG - Intronic
963485904 3:145934167-145934189 CTTCACATGGTCTTCTTATAAGG + Intergenic
964307141 3:155354055-155354077 CACCACATAGCCTTCTTACAAGG + Intergenic
965987548 3:174774153-174774175 CTGCATATGGCCTTCTTATATGG + Intronic
967954857 3:194870258-194870280 CTTCACGTGGCCTTCTTACAAGG + Intergenic
969094201 4:4719747-4719769 CTCCACATAGCCTTCTTATAAGG - Intergenic
969184846 4:5467454-5467476 CTTCATATGGCCTTCATATAAGG + Intronic
969220946 4:5758072-5758094 CTTCTCATGGCCTTCTTATAAGG - Intronic
969310937 4:6352949-6352971 CTCCACATGGCCTTCTCCTCTGG - Intronic
969486451 4:7474991-7475013 GTCCACATGACTTTCTTATAAGG + Intronic
969729429 4:8945220-8945242 CTCAACAGGGCTCTCTGATACGG - Intergenic
971855700 4:32040679-32040701 CTCCACAGGACTTTATTTTAGGG + Intergenic
972649545 4:41003566-41003588 TTTCACATGGCCTTCTTATAGGG - Intronic
972903153 4:43710303-43710325 CTTCACATGGCTTTCTTATAAGG - Intergenic
974263042 4:59549412-59549434 CTTCACATAGCCTTCTTATAAGG + Intergenic
976203999 4:82607261-82607283 GTTCACAGGGCCTTCTTATAAGG - Intergenic
977824522 4:101514976-101514998 CTCCAAAGCACCTTCTTACAAGG - Intronic
978144799 4:105359821-105359843 TTCCAGAGTGACTTCTTATATGG - Intergenic
979080256 4:116329807-116329829 CTCCCCTGAGCCTTTTTATAGGG - Intergenic
979765132 4:124455466-124455488 CTTCACATGGCCATCTTATAAGG + Intergenic
980873381 4:138635655-138635677 TTCCACAGGGCTATCTTATGGGG - Intergenic
984719276 4:182954937-182954959 CCCCACATGGCCTTCTTGTAAGG - Intergenic
985024090 4:185721847-185721869 CAACACAGGGCCTAATTATACGG - Intronic
985151046 4:186947096-186947118 CTCCACAGAGCCTTCCCAGAAGG - Intergenic
985644991 5:1080615-1080637 CTCCACTCGGCCTTCTTGTCGGG - Intronic
985913160 5:2898365-2898387 GGCCACAGGGCCTTCTTATAAGG + Intergenic
986215595 5:5716231-5716253 CTTCACTTGGCCTTCTTAAAAGG - Intergenic
986752665 5:10802944-10802966 ATCCACAGGTTCTTCTTACATGG + Intergenic
986753520 5:10812165-10812187 TTCCACAGGCCCTACTTCTATGG + Intergenic
987705830 5:21461257-21461279 CTCAACAGTTCCTTGTTATAGGG + Intergenic
988278806 5:29117471-29117493 CTGCATAGGGCCCTCATATAGGG - Intergenic
988364776 5:30282916-30282938 CTTCACATGGCCTTCTTCTAAGG + Intergenic
989094222 5:37766353-37766375 CTTCACCTGGCCTTCTTATAAGG - Intergenic
992115239 5:73533087-73533109 CTCCACAAAGCCTTCTTTTTTGG + Intergenic
993331208 5:86602679-86602701 CTCCAAAGGGGATTATTATAGGG + Intergenic
996411391 5:123163106-123163128 CTCCACAGAGCCTCTTTATAGGG + Intronic
996433170 5:123402889-123402911 CTCCACCAAGCCTTTTTATAAGG - Intronic
996487931 5:124058504-124058526 TTCCACATGGCCTTCTTCTTGGG + Intergenic
997444231 5:133929654-133929676 TGTCACATGGCCTTCTTATAAGG + Intergenic
997674455 5:135702323-135702345 CTTCACATGGCCTGCTGATAAGG - Intergenic
998527613 5:142857089-142857111 CTTCACAGGGCCTTCTTCCCTGG + Intronic
1001909896 5:175507194-175507216 TTGCACATGGCCTTCCTATAAGG + Intronic
1002682989 5:180982553-180982575 CTCCACAGGACCTTCCTCAACGG + Intergenic
1003946865 6:11084066-11084088 CTTCACATGGCCTTCTTATAAGG - Intergenic
1004515455 6:16318783-16318805 CCCCACAGGGCCTTCCCACAAGG - Intronic
1004564586 6:16784184-16784206 CTCCACATGGCCTTCTTGTAAGG - Intergenic
1004658524 6:17688604-17688626 CTCAACAGGGCATTCTTAGCAGG - Exonic
1006988164 6:38190843-38190865 CTGCCCAGGGCCTTCTTCTAGGG - Intronic
1007388098 6:41532862-41532884 CTTCACATGGACATCTTATAAGG - Intergenic
1007872629 6:45058566-45058588 CCCCACAGGTACTTCTGATAAGG - Intronic
1007990879 6:46254827-46254849 CTTCACATGGCTTTCTTATAAGG - Intronic
1010714505 6:79212691-79212713 CTGCACAATGCCTTCTAATATGG + Intronic
1012627931 6:101427066-101427088 CTCCACAGGCCCCTCTCATGGGG - Intronic
1013086115 6:106859258-106859280 ATCCACATTTCCTTCTTATAAGG - Intergenic
1014102506 6:117527346-117527368 CTCCACAGTGCCTTCATCTTGGG + Intronic
1018637765 6:165879451-165879473 CTGCACATGGCCTTCTTTTGAGG + Intronic
1020149508 7:5670841-5670863 CTACAGACGGCCTCCTTATATGG - Intronic
1020706794 7:11554270-11554292 CTTCACATGGCCTTCTCATAAGG - Intronic
1020732187 7:11894124-11894146 ATTCACATAGCCTTCTTATAAGG + Intergenic
1021684988 7:23176384-23176406 CTTCACATGGTGTTCTTATAAGG + Exonic
1022248541 7:28584420-28584442 CTCCACATGGCCTTCTTATAAGG - Intronic
1024975789 7:55112570-55112592 CTCCACAGGGCCTTCTGAGGGGG - Intronic
1025873372 7:65456247-65456269 CTCCACACGGACTTGTTTTAAGG + Intergenic
1028555130 7:92115378-92115400 CTTAACATGGCATTCTTATAAGG - Intronic
1031579338 7:123451904-123451926 TTACAAAGGGCCTTATTATAAGG - Intergenic
1032726387 7:134593238-134593260 CTTCACATGACCTTCTTATGAGG + Intergenic
1033440438 7:141373593-141373615 CTCAACTGGGACTTCTTAGAAGG - Intronic
1034542229 7:151765581-151765603 CATCACTGGGCCTTCTTTTAAGG + Intronic
1035261603 7:157665061-157665083 CTCCACAGCGCCTGCTTGCAGGG + Intronic
1037641615 8:20749621-20749643 GGCCACAGGGCCTTCTTATAAGG - Intergenic
1038741142 8:30218193-30218215 CTTCACATGGCCTTCTTATAAGG - Intergenic
1042031300 8:64478791-64478813 CTCCAAAGAGCCTTCATATTTGG - Intergenic
1042968669 8:74384042-74384064 CTTCACAGGAACTTCTTATTTGG + Intronic
1043356956 8:79424978-79425000 CTCCAGTGTCCCTTCTTATAAGG - Intergenic
1043993355 8:86782576-86782598 CTTTACATGGCCTTCTTATAAGG + Intergenic
1044063569 8:87669891-87669913 CTTCACATGGCCTTCTTATAAGG + Intergenic
1044116201 8:88337316-88337338 CTCCAGAGTCTCTTCTTATAAGG + Intergenic
1047785824 8:128153147-128153169 CTCCACACGGCCTTCTTACAAGG + Intergenic
1048527249 8:135214395-135214417 CTTCACAGGGTCTTCTCATTAGG - Intergenic
1048846523 8:138607764-138607786 CTCCATAGGGCCATTTTTTAAGG - Intronic
1048967509 8:139625239-139625261 TTCCACAGGGCCTTCTTAGCCGG + Intronic
1056545791 9:87612358-87612380 CTCCACAGGGCCTTCTTATAAGG - Intronic
1056598865 9:88030323-88030345 CTCAACAGGTCTTTATTATAAGG + Intergenic
1057544618 9:96008310-96008332 CTCACCAGTGCCTTCTTAAAAGG + Intronic
1058165215 9:101611349-101611371 CTCCACAGGGTCTCCTTATAAGG + Intronic
1058450159 9:105089014-105089036 CTCCACAGGGCATATTTACATGG - Intergenic
1058526745 9:105866657-105866679 CTCCACAGGTGATTCTTATCAGG - Intergenic
1058610233 9:106768447-106768469 CTTCCTAGGGCCTTATTATAAGG + Intergenic
1058686141 9:107481657-107481679 CTCCCCTGGGCTTCCTTATATGG + Intergenic
1061254454 9:129446100-129446122 GTCCACATTTCCTTCTTATAAGG + Intergenic
1185847012 X:3447191-3447213 CCCCAGAGTGTCTTCTTATAAGG - Intergenic
1186417903 X:9399526-9399548 GTCCACATTTCCTTCTTATAAGG - Intergenic
1186711514 X:12202757-12202779 CTTCACATAGCCTTCTTATTAGG - Intronic
1187228873 X:17401764-17401786 CTTTACATGGCCTTATTATAAGG + Intronic
1188878486 X:35462122-35462144 CTCCACAGCTCCTAGTTATAAGG - Intergenic
1189137005 X:38561018-38561040 CCCCCCAGGGCCTTCTCACATGG - Intronic
1189158312 X:38783111-38783133 CTTCATATGGACTTCTTATAAGG - Intergenic
1193467877 X:81869205-81869227 CTGCACAGAGCCTCCTTCTAAGG + Intergenic
1193976435 X:88125359-88125381 CACCTCAAAGCCTTCTTATAGGG - Intergenic
1194474427 X:94341232-94341254 CTCAACAAAGACTTCTTATAAGG - Intergenic
1194591873 X:95809217-95809239 CCTCATATGGCCTTCTTATAAGG + Intergenic
1194733191 X:97480189-97480211 TCCCACATGGCCTACTTATAAGG - Intronic
1195634755 X:107101482-107101504 CTTCACATGTCCTTCTTATAAGG - Intronic
1196693459 X:118585452-118585474 CATCACATGACCTTCTTATAAGG + Intronic
1199428706 X:147734060-147734082 CTCCATATGGCCTTTTTACACGG - Intergenic
1199740864 X:150735003-150735025 CTCTACATGGCTTTCTTATACGG - Intronic