ID: 1056548917

View in Genome Browser
Species Human (GRCh38)
Location 9:87635530-87635552
Sequence AATGGACCAGTTTTAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056548907_1056548917 19 Left 1056548907 9:87635488-87635510 CCCTCACCTTCTTCCTGGGAAGC 0: 1
1: 0
2: 3
3: 46
4: 361
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data
1056548906_1056548917 20 Left 1056548906 9:87635487-87635509 CCCCTCACCTTCTTCCTGGGAAG 0: 1
1: 0
2: 1
3: 48
4: 387
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data
1056548903_1056548917 24 Left 1056548903 9:87635483-87635505 CCTTCCCCTCACCTTCTTCCTGG 0: 1
1: 0
2: 11
3: 119
4: 988
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data
1056548908_1056548917 18 Left 1056548908 9:87635489-87635511 CCTCACCTTCTTCCTGGGAAGCA 0: 1
1: 0
2: 3
3: 34
4: 336
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data
1056548912_1056548917 6 Left 1056548912 9:87635501-87635523 CCTGGGAAGCACAGTGGTTAGGC 0: 1
1: 0
2: 2
3: 15
4: 193
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data
1056548909_1056548917 13 Left 1056548909 9:87635494-87635516 CCTTCTTCCTGGGAAGCACAGTG 0: 1
1: 0
2: 4
3: 33
4: 310
Right 1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056548917 Original CRISPR AATGGACCAGTTTTAGGAGG AGG Intronic
No off target data available for this crispr