ID: 1056549013

View in Genome Browser
Species Human (GRCh38)
Location 9:87636069-87636091
Sequence GTTCCGTGGGCAGACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056549013 Original CRISPR GTTCCGTGGGCAGACAGTGT GGG Intronic
913315030 1:117542493-117542515 GTGCTGTGGGCAGAGAGAGTTGG + Intergenic
1075564198 10:123491884-123491906 GTTCAGTGGACAGGCAGTGATGG + Intergenic
1075727619 10:124618583-124618605 CTTCCATGGGCAGATTGTGTGGG + Exonic
1077108917 11:853604-853626 GTTCCTGGGGCAGCCAGGGTGGG + Intronic
1079473001 11:20797785-20797807 GTGCCCTGGGCAGATAGAGTGGG + Intronic
1090804565 11:130194709-130194731 GTTCCATGTGCAGTCAATGTTGG - Exonic
1094502963 12:31036821-31036843 GTTCCGTGGGCACAGAGGGGTGG - Intergenic
1098258495 12:68643008-68643030 GGACCGTGGGCAGCCAGGGTCGG - Intronic
1098429984 12:70408585-70408607 CTGCCGTGGGCAGTCAGTCTCGG + Intronic
1101798715 12:108001866-108001888 TTTCCCTGGGCAGAGACTGTGGG + Intergenic
1102105339 12:110316707-110316729 GCTCTGTGGGCACACAGTGAGGG + Intronic
1103389149 12:120557945-120557967 GTTCTGTGGTCAGCCAGTCTTGG + Intronic
1103897099 12:124279976-124279998 GATCCCAGGGCAGCCAGTGTGGG + Intronic
1104800892 12:131554675-131554697 GTTTGGTGGGCAGGGAGTGTGGG - Intergenic
1107283895 13:38767711-38767733 GTTCCTTGTGCACACAGAGTTGG - Intronic
1107688271 13:42925936-42925958 GTTCATTGGGCAGAAACTGTAGG + Intronic
1108964915 13:56286235-56286257 GTTCCGTGGGCAGAGACTCTCGG + Intergenic
1111584403 13:90265636-90265658 GTTGGATGGGCAGAAAGTGTGGG - Intergenic
1116433970 14:44876340-44876362 GTGCAGAGGGCAGAAAGTGTAGG + Intergenic
1117901425 14:60537894-60537916 GATCAGTGGGCCAACAGTGTTGG + Intergenic
1124816812 15:33001905-33001927 GTTCCATGGGCAGTAAGTGGGGG - Intronic
1124958291 15:34374546-34374568 GTTCCGTGGGCACCCCGTGATGG + Intergenic
1129799985 15:78406264-78406286 GGTCCGTGGGCAGACACAGGCGG - Intergenic
1133213831 16:4278591-4278613 GTTCCTTGGGGACACAGAGTGGG - Intergenic
1139512220 16:67433992-67434014 GCTCCATGGGCAGCCAGTGAGGG - Intronic
1140325029 16:73993296-73993318 GTTACGGTGGCAGACAGTGCTGG - Intergenic
1142102986 16:88285421-88285443 GGGCTGTGGGGAGACAGTGTGGG + Intergenic
1143651585 17:8266924-8266946 GTGCAGTGGGCAGTCAGAGTGGG + Intronic
1145395463 17:22490632-22490654 GGTGGGTGGGCAGAGAGTGTTGG + Intergenic
1146451623 17:32979142-32979164 GTTCAGGAGGCAGAGAGTGTTGG + Intronic
1147744587 17:42687517-42687539 GTTCCGAGGGCCGACTGGGTTGG + Intronic
1148902832 17:50891457-50891479 GTTCAGAGGGTCGACAGTGTCGG - Intergenic
1149301490 17:55308237-55308259 GTTCAGAGGACAGACAGTGCTGG + Intronic
1151591345 17:75046930-75046952 GGACCGTGGGCAGCCAGGGTCGG - Exonic
1151930380 17:77228268-77228290 GCTCGGGGGGCACACAGTGTGGG + Intergenic
1156269379 18:35517028-35517050 GGGCAGTGGGCAGACAGTGACGG - Intergenic
1157281464 18:46348862-46348884 GTTCTGTGGTCAGATAGTTTTGG - Intronic
1160131152 18:76225982-76226004 GTTTCCTGAGCAGACAGTGCAGG + Intergenic
1160490025 18:79329150-79329172 GTGCAGTGGACAGAGAGTGTGGG + Exonic
1162617859 19:11816149-11816171 GTTCCATTGGCAGAAAGGGTGGG + Intronic
1162630898 19:11925959-11925981 GTTCCATTGGCAGAAAGGGTGGG + Intronic
1165073864 19:33270091-33270113 GCTCCATGGGGAGACAGTGAGGG + Intergenic
926182567 2:10658716-10658738 ATTCTGTGGTCAGACAGTCTTGG - Intronic
927971995 2:27311694-27311716 GGTCAGTGGGCAGACACTCTGGG + Intronic
928477698 2:31647339-31647361 GTTCCATGGGCTATCAGTGTGGG - Intergenic
930061075 2:47289408-47289430 GTTTCCTGGGAAGACACTGTAGG + Intergenic
932479365 2:72029331-72029353 GTCCTGTGGGCAGAGATTGTGGG + Intergenic
938622935 2:133076281-133076303 GTTCCTTGGACATACAGTATAGG - Intronic
945044316 2:205768461-205768483 GTTCTGTGTGCACACCGTGTCGG + Intronic
946891754 2:224283940-224283962 TTTGCATTGGCAGACAGTGTAGG + Intergenic
1169528289 20:6454719-6454741 GATCCTTGGGCAGAGAGTGCTGG - Intergenic
1169896822 20:10513342-10513364 GTTCTGGAGCCAGACAGTGTAGG - Intronic
1170875628 20:20247375-20247397 GCTGCGTGGGCAGACTGAGTGGG + Intronic
1171368441 20:24644072-24644094 GTTCCCTGGGAATAAAGTGTGGG - Intronic
1171464796 20:25319919-25319941 GTTCCGTGGGGACCAAGTGTGGG - Intronic
1173799521 20:45886451-45886473 GGTTCTTGGGCAGACAGGGTTGG - Intergenic
1175791920 20:61745276-61745298 GTTCCTTGGTCAGACAGTTTGGG - Intronic
1177956022 21:27600441-27600463 GATACATGTGCAGACAGTGTAGG + Intergenic
1178430241 21:32512516-32512538 GTACCCAGGGCAGACAGAGTAGG - Intronic
1184938107 22:47739858-47739880 GGTCCGGGGGAAGCCAGTGTGGG + Intergenic
950429848 3:12944449-12944471 GCTCTGGGGTCAGACAGTGTGGG - Intronic
953191475 3:40691522-40691544 GTTCTGTGGGCAGTAAGAGTGGG + Intergenic
953725228 3:45391857-45391879 GTTGTGTAGACAGACAGTGTAGG + Intronic
956530953 3:70218054-70218076 GTTCATTGGGCACACAGAGTGGG - Intergenic
960629045 3:119710309-119710331 GTCCAATGGGCAGTCAGTGTCGG + Intronic
960989640 3:123302040-123302062 GTGCTGTGGGCTGTCAGTGTGGG - Intronic
961525829 3:127496742-127496764 GGTCCGTGGGCAGCCATGGTCGG - Intergenic
961904920 3:130252946-130252968 GAATCTTGGGCAGACAGTGTTGG + Intergenic
965403020 3:168236165-168236187 GTTAGGTGGGCAGAAAATGTTGG + Intergenic
968573335 4:1353764-1353786 GATCCCTGGGCAGGCTGTGTGGG + Intronic
970879849 4:20916272-20916294 GTTACGTGGGCAGGAAATGTGGG - Intronic
973123596 4:46555346-46555368 GTTCAGTGAGCAGAAATTGTTGG - Intergenic
983597778 4:169490032-169490054 GTACCGTGGGGAGACTTTGTTGG - Intronic
984781009 4:183525746-183525768 GGCCCGTGGCTAGACAGTGTCGG - Intergenic
992027033 5:72680974-72680996 GTCCCCTGGGCAGCTAGTGTGGG + Intergenic
994208947 5:97066581-97066603 ATTCTGTGGGCTGGCAGTGTAGG - Intergenic
998080809 5:139273792-139273814 GTTCCGGGGGCGCTCAGTGTGGG + Exonic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003240958 6:4345509-4345531 GTTCTGTAGGCAGACAGAGGAGG - Intergenic
1003362022 6:5436111-5436133 GTACCGTGGGCACAATGTGTGGG + Intronic
1004520409 6:16356192-16356214 GTGCCGTGGGCAGGAAATGTAGG - Intronic
1010597430 6:77781018-77781040 GTTCTGTGGGCATGCAGTCTCGG - Intronic
1012921428 6:105224285-105224307 GTTAGGAGGGCAGACAGTGATGG + Intergenic
1015571392 6:134624818-134624840 GGTCAGTGAGCAGAAAGTGTAGG - Intergenic
1023121079 7:36909459-36909481 GTTCCTTGGGCATTCATTGTAGG - Intronic
1028185906 7:87785150-87785172 GTTCCTGGGGCAGACACTGGAGG - Intronic
1037315195 8:17593998-17594020 GTTCAGTGGGCACATAGTTTCGG - Intronic
1037897950 8:22670668-22670690 GTAGCCTGGGCAGAGAGTGTGGG + Intergenic
1041313333 8:56538183-56538205 GGTCTGTGTGCAGCCAGTGTAGG - Intergenic
1041652619 8:60315965-60315987 GTTCCGTGGGGAGGAATTGTTGG - Intergenic
1041800159 8:61789772-61789794 GGTCCCTGGGCAGGCAGTGCTGG + Intergenic
1042825638 8:72976390-72976412 ATTCCATGGGCTGACAATGTGGG - Intergenic
1045492274 8:102679218-102679240 GCTCCTTGGGCAGGCAGTATGGG - Intergenic
1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG + Intergenic
1049207326 8:141369633-141369655 GCCCCTTGGGCAGACACTGTAGG + Intergenic
1049772613 8:144390757-144390779 GTGCCCTGGGCACACAGTGGTGG + Intronic
1050179135 9:2900819-2900841 GGACCGTGGGCAGCCAGGGTTGG - Intergenic
1052401185 9:28002158-28002180 GTCCTGGGAGCAGACAGTGTAGG + Intronic
1054142396 9:61539955-61539977 AGCCCATGGGCAGACAGTGTTGG - Intergenic
1054462140 9:65471105-65471127 AGCCCATGGGCAGACAGTGTTGG - Intergenic
1056549013 9:87636069-87636091 GTTCCGTGGGCAGACAGTGTGGG + Intronic
1059345142 9:113623265-113623287 GTTCCCTGAGCAGACAGTCCGGG + Intergenic
1062669717 9:137700924-137700946 GTTCTGTGGGCAGGCTGTATAGG + Intronic
1193487649 X:82106941-82106963 GTGCATTGGGCACACAGTGTTGG + Intergenic
1196217760 X:113073350-113073372 CTTCCCTGGGTAGACATTGTGGG + Intergenic
1200152756 X:153959332-153959354 GTTCCCTGGGCACTCTGTGTTGG + Exonic
1201987014 Y:19979762-19979784 GTTCCTTGGGCATAGAGAGTTGG + Intergenic
1202114679 Y:21460024-21460046 GTTCCGTGGTTAGCCACTGTTGG + Intergenic