ID: 1056555658

View in Genome Browser
Species Human (GRCh38)
Location 9:87685163-87685185
Sequence CTGTAGGAAAGTTGGCAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555658_1056555661 -5 Left 1056555658 9:87685163-87685185 CCTATCTGCCAACTTTCCTACAG 0: 1
1: 0
2: 2
3: 9
4: 198
Right 1056555661 9:87685181-87685203 TACAGAAATAGAATATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555658 Original CRISPR CTGTAGGAAAGTTGGCAGAT AGG (reversed) Intronic
900420850 1:2555395-2555417 CTGCAGGAGAGTTGGCAGGGTGG - Intergenic
900811114 1:4801992-4802014 CTGCAGGAAGGTAGCCAGATAGG + Intergenic
903355234 1:22742336-22742358 ATGGAGGAAAGTTGGTAGAAAGG + Intronic
904976429 1:34460479-34460501 CAGGAGGCAAGTTGGCAGAAGGG - Intergenic
905417120 1:37811712-37811734 CTCTGGGATAGTTGGTAGATCGG - Exonic
905870255 1:41399460-41399482 CTGTAGGGAAGTGAGCAGAGGGG - Intergenic
906028154 1:42693069-42693091 CTCAAGGAAAGTTGGTAGTTGGG + Intronic
907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG + Intronic
908590997 1:65633198-65633220 CTGTTGGGAAGTTGGCACATTGG - Intronic
911189520 1:94933656-94933678 GTGGAGGTAAGTTGGCAGCTCGG + Intergenic
912060618 1:105663981-105664003 ATGTAGCCATGTTGGCAGATAGG + Intergenic
913063732 1:115230982-115231004 ATGTAGCAAAGTGGGCAGTTGGG - Intergenic
914213597 1:145604626-145604648 CTCTAGGAAAGTTTTGAGATGGG + Intergenic
917802446 1:178582718-178582740 CTGTAGGATATGTGGCAGATTGG + Intergenic
917966823 1:180184029-180184051 CTGTTTGGAAATTGGCAGATCGG + Exonic
919520655 1:198583239-198583261 CTCTGGGCAAGATGGCAGATAGG - Intergenic
921990792 1:221364419-221364441 CTGTAGTATAGTTTGCAGTTGGG - Intergenic
1066254182 10:33662699-33662721 CTTTAGGAAAGTATGCAGTTGGG - Intergenic
1066276781 10:33876640-33876662 TTGTAGAAAAGTTGGCAGCAAGG + Intergenic
1066340224 10:34525510-34525532 ATGTTGGAAGGTTGGCAGAGTGG - Intronic
1069864244 10:71491677-71491699 TTTCAGCAAAGTTGGCAGATGGG + Intronic
1070560757 10:77564969-77564991 GTGAAGGAAAGCTGGCAGAGTGG + Intronic
1070986723 10:80696004-80696026 CTGTCGTAACCTTGGCAGATGGG + Intergenic
1074781993 10:116808852-116808874 CTGTAGGAAAGTCTGAACATAGG - Intergenic
1075016275 10:118912097-118912119 TTGGAGAAAAGTGGGCAGATTGG - Intergenic
1075712676 10:124539013-124539035 TTGCAGCAACGTTGGCAGATGGG + Intronic
1076020487 10:127068426-127068448 CTGTAGGAGAGGTGCCAGACAGG - Intronic
1076097445 10:127743469-127743491 CTGTGGAAAAGTGAGCAGATGGG - Intergenic
1078972135 11:16426392-16426414 CTGTAGTATAGTTTGAAGATGGG - Intronic
1079053913 11:17188654-17188676 CTGTAGGAGAGTTGGTAGATGGG - Intronic
1081050856 11:38339296-38339318 CAGTAGAAAAGTTGGAAGTTAGG + Intergenic
1083510066 11:63201242-63201264 CTGTAGTAAAGTTTGAAGTTGGG - Intronic
1084557843 11:69885581-69885603 CTGTAGGAATGAGGGCAGAGTGG + Intergenic
1085291456 11:75403112-75403134 CTGTAGGAAGGTTGACTGGTAGG + Intronic
1086740413 11:90361229-90361251 CTGTAGTATAGTTTGAAGATGGG + Intergenic
1087027732 11:93666997-93667019 TTGTAGAAGAGTTGGAAGATAGG + Intronic
1087425989 11:97986610-97986632 ATGTTTGAAAGTTGGCAGACTGG + Intergenic
1087615797 11:100485896-100485918 TTGTAGGAAAAATGGCAGATAGG + Intergenic
1089033409 11:115358142-115358164 CTATAGGAAGGATGACAGATGGG - Intronic
1090414219 11:126529432-126529454 CTGTAGGAAAGGAGCCTGATGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091952506 12:4606680-4606702 CTGTAGGAAATTTGAAACATAGG - Intronic
1093720426 12:22436578-22436600 CTGTAGGGATCATGGCAGATGGG + Intronic
1094323371 12:29209564-29209586 CTGGAGGAAAACTGGAAGATGGG + Intronic
1095694098 12:45124862-45124884 CTGTAGGAAGGCTGTCACATTGG + Intergenic
1096042858 12:48534462-48534484 CTGTAGTATAGTTTGCAGTTGGG - Intergenic
1096430998 12:51542678-51542700 CTAAAGGAAACATGGCAGATGGG + Intergenic
1096646410 12:53039624-53039646 CTGCAGGAAAGATGGCAAAAAGG + Exonic
1098679324 12:73330477-73330499 TTATAGTCAAGTTGGCAGATAGG - Intergenic
1099014368 12:77326259-77326281 TTTTAGGAAAGTTGGGAGACAGG + Intergenic
1101727931 12:107403380-107403402 CCATAGGAAGCTTGGCAGATGGG + Intronic
1102407906 12:112690143-112690165 TTGTAGAAAAGTTGGAAAATTGG + Intronic
1105314324 13:19243445-19243467 CTGAGGGAAAAATGGCAGATGGG + Intergenic
1107833816 13:44397768-44397790 CTCAAGGAAAGTTGGGAGGTGGG + Intergenic
1108143239 13:47448649-47448671 CTGTAAGATAGTTCACAGATTGG - Intergenic
1108212567 13:48153034-48153056 CTGTTGGAAGGATGGGAGATGGG - Intergenic
1110844012 13:80173478-80173500 ATGTGGGAAAGCTGCCAGATTGG + Intergenic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1116757956 14:48971425-48971447 CTGGGGGAAAGTTGTCAAATAGG + Intergenic
1120110519 14:80549242-80549264 CAGTGGGAAACTTGGCAGAACGG + Intronic
1120777400 14:88452688-88452710 CTGGAGGGAAGATGGTAGATAGG - Intronic
1121252710 14:92511735-92511757 CTGTAGGAATCTGGGCAGAGGGG + Intergenic
1123672363 15:22672013-22672035 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124324409 15:28745306-28745328 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124528288 15:30478348-30478370 CTTGAGGGAAGTTGGCAAATAGG + Intergenic
1124770369 15:32529355-32529377 CTTGAGGGAAGTTGGCAAATAGG - Intergenic
1127329852 15:57928087-57928109 CTGTTGGAAGGTTGGGGGATAGG - Intergenic
1128019677 15:64379717-64379739 CAGTAGGAAATTTGGCAGACAGG - Intronic
1130066005 15:80605616-80605638 CTTTAGAAAAGTTTTCAGATAGG + Intergenic
1130791964 15:87164869-87164891 AGGTAGGAAAGGTGGCAGGTAGG - Intergenic
1142392742 16:89813116-89813138 CGGTAGAAAAGTAGACAGATGGG + Intronic
1147699924 17:42387683-42387705 CTGTAGGGAAATTGACAGACCGG - Intronic
1149084488 17:52698838-52698860 CTGTAGGAAATTTGGCTAAACGG - Intergenic
1149972830 17:61236233-61236255 CTGTAGGAAAGTGGGAGGACAGG + Intronic
1152682338 17:81675183-81675205 TTGTAGGAAAGTTGACAACTAGG - Intergenic
1158951140 18:62496305-62496327 GTGGAGGAAAGTTGGAAGAGTGG - Intergenic
1159290475 18:66412320-66412342 CTGTAGGATAGTTTGAAGTTGGG - Intergenic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1163233372 19:16018157-16018179 CTGTAGGAAAGTGGGCCTCTTGG + Intergenic
1163878004 19:19891877-19891899 GTGTAGTAAGGTTTGCAGATTGG - Exonic
1164133817 19:22392385-22392407 GTGTAGTAAGGTTTGCAGATTGG + Exonic
1164164991 19:22664374-22664396 GTGTAGTAAGGTTTGCAGATTGG - Exonic
1164166793 19:22685760-22685782 GTGTAGTAAGGTTTGCAGATTGG - Intergenic
1164215234 19:23138913-23138935 CTGTAGGAAAATAAGCAAATAGG + Intronic
1166368480 19:42289158-42289180 CTGCAGGATAGGTGGCAGAGAGG - Intronic
927356073 2:22174496-22174518 ATGCAGGAAACTTTGCAGATTGG - Intergenic
927968128 2:27284801-27284823 CTGTAGAAAAGTGGTCAGAAGGG + Intronic
928388370 2:30888920-30888942 CAGTAGGAAAATTGGGAGGTGGG - Intergenic
928879151 2:36077476-36077498 GTGTAGGAAATTTGGAAGAAGGG + Intergenic
929023767 2:37579256-37579278 CTGTGGGGAAGTGGGCACATTGG - Intergenic
929134651 2:38611947-38611969 CTGTAGGAGTCTTGGCAAATTGG + Intergenic
929178046 2:39001865-39001887 GGGTACGAAGGTTGGCAGATGGG + Intronic
929627538 2:43424878-43424900 CTGTAGGAAAAGTGACTGATTGG - Intronic
931230639 2:60371781-60371803 GTGGAGGAAGGTTGGCAGAGGGG + Intergenic
931487772 2:62710214-62710236 CTGTATGAAAGTTGGCAAGTTGG + Intronic
934974149 2:98788589-98788611 CTGCAGAACAGTTAGCAGATGGG - Intergenic
935201192 2:100857949-100857971 CTGTAGGCAAGTTGGAAAACTGG + Intronic
943977978 2:194508264-194508286 CTGTAGGAAAGCTTACAGAGGGG + Intergenic
943982764 2:194576007-194576029 CATTAGAAAAGTTTGCAGATAGG - Intergenic
946960892 2:224984700-224984722 ATGTAGGAAAGTTGCAAGAAAGG + Intronic
948251220 2:236531498-236531520 GTTTAGGAAAGTGGGGAGATGGG - Intergenic
1169871760 20:10255193-10255215 CTTTTGGAAACTTGGCAGGTTGG - Intronic
1170086188 20:12535110-12535132 TTGTGGGGAAGATGGCAGATAGG + Intergenic
1170317688 20:15060563-15060585 CTGGGGGAAAGTTGGAAGATGGG - Intronic
1170858625 20:20081632-20081654 GTGTAGGAAAGGAGGCAGAAAGG - Intronic
1172802122 20:37583077-37583099 TTGTAAGAAAGTATGCAGATGGG + Intergenic
1174179464 20:48665907-48665929 CTGTGGGACAGTGGGCAGGTGGG - Intronic
1174527254 20:51183148-51183170 CTTTAGGGAAATTGGCAGAAAGG + Intergenic
1177208655 21:18042290-18042312 CTGTAAGAAGGTTTGCAGAAGGG - Intronic
1181002700 22:19995297-19995319 GTGTAGGAGGGTGGGCAGATGGG + Intronic
1182794698 22:32983208-32983230 CAGTAAGAGAGTTGACAGATTGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
951261240 3:20512123-20512145 CTGTAGGAAAGGATGAAGATAGG + Intergenic
951813407 3:26726724-26726746 CTGAGGAAAAGTTGGCAGGTTGG - Intergenic
952707289 3:36392207-36392229 CTGTAGGGAGGTTGGACGATGGG - Intronic
953232999 3:41081072-41081094 CTGTATGGAAGATGGCAGAAAGG + Intergenic
953363456 3:42321743-42321765 CAGAAGGAATGTTGGCAGAAGGG - Intergenic
953411693 3:42693819-42693841 CTGCAGGAAAGATGGGAGAAGGG + Intronic
957771760 3:84703263-84703285 CTGTAGTAAAGTTTGAAGTTGGG - Intergenic
959651995 3:108759082-108759104 CTCCAGGAAAGTGGGCAGAAAGG - Intergenic
962044328 3:131739568-131739590 CTATAGGAAAGTAGACAGTTTGG + Intronic
962176832 3:133163849-133163871 CTGTGGGAAACTTGGTAGCTAGG - Intronic
963676974 3:148324526-148324548 CTGTAGGAACGTTTGAAGTTGGG - Intergenic
964195303 3:154057629-154057651 ATGTTGGTAAGTTGCCAGATTGG + Intergenic
965881577 3:173395103-173395125 ATGTAAGTAAGTTGGAAGATAGG - Intergenic
966713698 3:182994687-182994709 CTGTAGTATAGTTCGAAGATTGG + Intergenic
966735949 3:183187279-183187301 CTGTAGTAAGGCTGGCAGACAGG + Intronic
967136381 3:186516114-186516136 ATGGAGGACAGTTGGTAGATGGG - Intergenic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970169472 4:13275453-13275475 TTGTGGGAAAGATGGGAGATGGG - Intergenic
970321045 4:14875623-14875645 CTGTAGGATAGTTTGAAGTTGGG - Intergenic
972225736 4:37009484-37009506 CTGTAGCTAAGTTGGCATGTGGG - Intergenic
973797666 4:54444795-54444817 CTGTAGTCAAGATTGCAGATGGG - Intergenic
974402084 4:61420701-61420723 CTGCAGGAAAGTTTAAAGATAGG + Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976840336 4:89425461-89425483 CTGTTGTAAAGGTGGCAGAGAGG + Intergenic
981759417 4:148177386-148177408 CTGAAGGAAAGTTAGCTGAATGG + Intronic
982090599 4:151876808-151876830 CTGGAGGAAAGATGGTAGAATGG - Intergenic
983126527 4:163959400-163959422 CTGTAGTATAGTTTGAAGATGGG - Intronic
986082648 5:4410189-4410211 ATGTGGGGAAGATGGCAGATGGG + Intergenic
986659380 5:10045421-10045443 CTGCAGGACAGTGGGAAGATCGG - Intergenic
989684871 5:44073794-44073816 CTGTAGGAAAAATTCCAGATTGG + Intergenic
989739477 5:44753453-44753475 CTCTCTGAAAGTTGGGAGATGGG - Intergenic
989797239 5:45490782-45490804 ATGTATGAAAGTTGGAAGAAAGG - Intronic
990397437 5:55396919-55396941 ATGGAAGAAAGTTTGCAGATAGG + Intronic
992598690 5:78373449-78373471 CTGTAGGAAAGTTGCTATGTAGG + Intronic
992598692 5:78373465-78373487 ATGTAGGAAAGTTGCCACATGGG + Intronic
992766987 5:80010537-80010559 CTGTAGAAAGGTAGGCAGAGAGG + Intronic
993362359 5:86993486-86993508 CTGTAGGATAGTTTGCATCTGGG + Intergenic
994242877 5:97444834-97444856 CTGTAGTATAGTTGGAAGTTGGG - Intergenic
994887322 5:105581825-105581847 TTGAAGGAAAAATGGCAGATAGG + Intergenic
996452280 5:123639122-123639144 CTGAAGAGAAGTTGGCAGTTAGG + Intergenic
996454817 5:123668789-123668811 CTGTAGTAAAGTTTGAAGTTGGG - Intergenic
997031076 5:130129087-130129109 CTTGAGGAAACTTGGCACATAGG - Intronic
998228099 5:140342281-140342303 CAGTAGGAAACATGGCAGAGTGG - Intronic
998741647 5:145209965-145209987 TACTAGGAAAGATGGCAGATAGG + Intergenic
1000505778 5:162115979-162116001 TTGTAGAAAAGTTGACAGAGAGG + Intronic
1000683233 5:164213472-164213494 CTGTAGGACAGTTGGCACTATGG + Intergenic
1001728668 5:173930691-173930713 TTGTAGGAAAATTGGCAGCCGGG + Intronic
1005247567 6:23905924-23905946 CTGTAGGAAAAAGGGCAGAGAGG - Intergenic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1007883293 6:45191609-45191631 CTGTAGGGAGGGTGGCAGGTAGG + Intronic
1008168062 6:48165446-48165468 CTGGAGAAGAGTAGGCAGATTGG + Intergenic
1009953083 6:70418988-70419010 ATTTAGGAAAGATGGCAGCTAGG + Intronic
1011202618 6:84853673-84853695 CTGTAGAAAACTTGGAAAATAGG + Intergenic
1013483217 6:110569784-110569806 TTTTGGGAAAGATGGCAGATTGG + Intergenic
1014006074 6:116419609-116419631 CTGCAGCAAAGCTGGCAAATGGG + Intronic
1016022365 6:139249576-139249598 CTGAATGAAAGCTGGCAGATTGG + Intronic
1016778037 6:147927069-147927091 CTGTAGTATAGTTGGAAGTTGGG + Intergenic
1018151784 6:160946411-160946433 CTGAAGGAGAATTGGCAGGTGGG - Intergenic
1019065667 6:169294538-169294560 CTGGAGGAAAGAAGGCAGACAGG - Intergenic
1021116506 7:16751419-16751441 TTGTAGGAGAGTTGTCTGATAGG - Intergenic
1021243493 7:18233887-18233909 CTGTAGGAAACTTGGCAAATAGG + Intronic
1021569450 7:22049710-22049732 CGTTAGGATAATTGGCAGATTGG + Intergenic
1025991479 7:66500588-66500610 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1026575945 7:71571592-71571614 CTGTCTAAAAGTTGGCTGATAGG + Intronic
1027213744 7:76170446-76170468 CTGTAGAAAAATTGGAAAATAGG + Intergenic
1029158672 7:98535417-98535439 CTGTAGGGAAGTGGGGACATTGG + Intergenic
1030371488 7:108704587-108704609 CTGTAGTATAGTTTGAAGATGGG - Intergenic
1030374636 7:108741022-108741044 CTGTAGTATAGTTTGAAGATGGG + Intergenic
1030925692 7:115451373-115451395 CAGTAAGAAAATTTGCAGATAGG + Intergenic
1033961578 7:146919953-146919975 ATGGAGGAAAATTGGCAGATAGG - Intronic
1035859168 8:3009476-3009498 CTGAAGAAAAGTTTGCAAATTGG - Intronic
1037986594 8:23294299-23294321 CTGTAGAACAGTGGGCAGCTTGG + Intronic
1041962854 8:63639036-63639058 CAGTAGGTAAGTAGGTAGATAGG - Intergenic
1042092814 8:65177634-65177656 CTTTAGGAAACTTGGCTGCTTGG + Intergenic
1043304516 8:78777958-78777980 ATGTAGAAAAGTTGGAAGGTAGG - Intronic
1047349872 8:124063697-124063719 CTGTTGGAAAGTCAGCAAATGGG + Intronic
1048318823 8:133382688-133382710 CTTCAGGAAATTTGTCAGATAGG + Intergenic
1048773109 8:137916743-137916765 CTGTATGACAGTTGGCCTATTGG - Intergenic
1052758100 9:32562209-32562231 TTATAGTAAAGTTGGAAGATAGG - Intronic
1053023044 9:34708955-34708977 CTGTAGGAACCTTGGCATCTCGG + Intergenic
1053077661 9:35148362-35148384 GTGTAGTAAGGTTTGCAGATTGG + Intergenic
1053116439 9:35508164-35508186 CTGTAGACACGTTTGCAGATTGG - Intronic
1055031376 9:71773907-71773929 CTGTAGGGAAGTAGGCAGGATGG - Intronic
1056555658 9:87685163-87685185 CTGTAGGAAAGTTGGCAGATAGG - Intronic
1059781686 9:117535433-117535455 CTGTTGAAATGTTGGAAGATAGG - Intergenic
1186591376 X:10933525-10933547 CTGGAGAAAAATTGGGAGATAGG - Intergenic
1186891316 X:13961761-13961783 TTTTAGTATAGTTGGCAGATTGG + Intergenic
1187595725 X:20770813-20770835 CTGAAGAAAAGTTGACAAATTGG + Intergenic
1188309085 X:28595623-28595645 CTGAAATAAAGTTGGCAGAGAGG - Intronic
1189602156 X:42638702-42638724 CAGAAGGTGAGTTGGCAGATTGG - Intergenic
1190371645 X:49748347-49748369 ATGTAAGAGAGTTGGCAGAGAGG - Intergenic
1191161934 X:57338999-57339021 CTGTAGTATAGTTGGAAGTTGGG - Intronic
1192469858 X:71388581-71388603 TTGTAGGAAACTTAGCAGCTGGG + Intronic
1193425788 X:81338728-81338750 CAATAGGAAAATTGGCAGAATGG - Intergenic
1193954728 X:87845202-87845224 AAGTTGGAAAGATGGCAGATAGG - Intergenic
1195515351 X:105768276-105768298 CTGTAGGCAAACTGGTAGATAGG + Intergenic
1195611315 X:106870488-106870510 CTTTAGGAAAGTTGGGAACTAGG - Intronic
1198510238 X:137343217-137343239 ATGTAGTAAAGTTGGGAGAAGGG + Intergenic