ID: 1056555794 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:87686241-87686263 |
| Sequence | TCTGCTTAGGGTCAGCCAAC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056555794_1056555800 | 16 | Left | 1056555794 | 9:87686241-87686263 | CCCGTTGGCTGACCCTAAGCAGA | No data | ||
| Right | 1056555800 | 9:87686280-87686302 | AGCCTAGAGACACAATCCCTAGG | No data | ||||
| 1056555794_1056555803 | 30 | Left | 1056555794 | 9:87686241-87686263 | CCCGTTGGCTGACCCTAAGCAGA | No data | ||
| Right | 1056555803 | 9:87686294-87686316 | ATCCCTAGGACCAGCCACCCGGG | No data | ||||
| 1056555794_1056555802 | 29 | Left | 1056555794 | 9:87686241-87686263 | CCCGTTGGCTGACCCTAAGCAGA | No data | ||
| Right | 1056555802 | 9:87686293-87686315 | AATCCCTAGGACCAGCCACCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056555794 | Original CRISPR | TCTGCTTAGGGTCAGCCAAC GGG (reversed) | Intronic | ||