ID: 1056555794

View in Genome Browser
Species Human (GRCh38)
Location 9:87686241-87686263
Sequence TCTGCTTAGGGTCAGCCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555794_1056555803 30 Left 1056555794 9:87686241-87686263 CCCGTTGGCTGACCCTAAGCAGA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555794_1056555802 29 Left 1056555794 9:87686241-87686263 CCCGTTGGCTGACCCTAAGCAGA No data
Right 1056555802 9:87686293-87686315 AATCCCTAGGACCAGCCACCCGG No data
1056555794_1056555800 16 Left 1056555794 9:87686241-87686263 CCCGTTGGCTGACCCTAAGCAGA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555794 Original CRISPR TCTGCTTAGGGTCAGCCAAC GGG (reversed) Intronic