ID: 1056555798

View in Genome Browser
Species Human (GRCh38)
Location 9:87686254-87686276
Sequence TTGCCATGTGATTTCTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555798_1056555806 24 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555806 9:87686301-87686323 GGACCAGCCACCCGGGCAACAGG No data
1056555798_1056555811 30 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555811 9:87686307-87686329 GCCACCCGGGCAACAGGGCGGGG No data
1056555798_1056555810 29 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555810 9:87686306-87686328 AGCCACCCGGGCAACAGGGCGGG No data
1056555798_1056555803 17 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555798_1056555800 3 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555798_1056555807 25 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555807 9:87686302-87686324 GACCAGCCACCCGGGCAACAGGG No data
1056555798_1056555802 16 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555802 9:87686293-87686315 AATCCCTAGGACCAGCCACCCGG No data
1056555798_1056555809 28 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555798 Original CRISPR TTGCCATGTGATTTCTGCTT AGG (reversed) Intronic