ID: 1056555800

View in Genome Browser
Species Human (GRCh38)
Location 9:87686280-87686302
Sequence AGCCTAGAGACACAATCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555792_1056555800 25 Left 1056555792 9:87686232-87686254 CCACAGCCTCCCGTTGGCTGACC No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555797_1056555800 4 Left 1056555797 9:87686253-87686275 CCCTAAGCAGAAATCACATGGCA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555798_1056555800 3 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555791_1056555800 30 Left 1056555791 9:87686227-87686249 CCTCTCCACAGCCTCCCGTTGGC No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555793_1056555800 19 Left 1056555793 9:87686238-87686260 CCTCCCGTTGGCTGACCCTAAGC No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555795_1056555800 15 Left 1056555795 9:87686242-87686264 CCGTTGGCTGACCCTAAGCAGAA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data
1056555794_1056555800 16 Left 1056555794 9:87686241-87686263 CCCGTTGGCTGACCCTAAGCAGA No data
Right 1056555800 9:87686280-87686302 AGCCTAGAGACACAATCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555800 Original CRISPR AGCCTAGAGACACAATCCCT AGG Intronic