ID: 1056555801

View in Genome Browser
Species Human (GRCh38)
Location 9:87686282-87686304
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555801_1056555806 -4 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555806 9:87686301-87686323 GGACCAGCCACCCGGGCAACAGG No data
1056555801_1056555818 19 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555818 9:87686324-87686346 GCGGGGCAGAAAAGGTTGTGGGG No data
1056555801_1056555815 11 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555815 9:87686316-87686338 GCAACAGGGCGGGGCAGAAAAGG No data
1056555801_1056555816 17 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555816 9:87686322-87686344 GGGCGGGGCAGAAAAGGTTGTGG No data
1056555801_1056555807 -3 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555807 9:87686302-87686324 GACCAGCCACCCGGGCAACAGGG No data
1056555801_1056555809 0 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data
1056555801_1056555811 2 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555811 9:87686307-87686329 GCCACCCGGGCAACAGGGCGGGG No data
1056555801_1056555817 18 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555817 9:87686323-87686345 GGCGGGGCAGAAAAGGTTGTGGG No data
1056555801_1056555810 1 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555810 9:87686306-87686328 AGCCACCCGGGCAACAGGGCGGG No data
1056555801_1056555819 22 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555819 9:87686327-87686349 GGGCAGAAAAGGTTGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555801 Original CRISPR GTCCTAGGGATTGTGTCTCT AGG (reversed) Intronic