ID: 1056555803

View in Genome Browser
Species Human (GRCh38)
Location 9:87686294-87686316
Sequence ATCCCTAGGACCAGCCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555795_1056555803 29 Left 1056555795 9:87686242-87686264 CCGTTGGCTGACCCTAAGCAGAA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555797_1056555803 18 Left 1056555797 9:87686253-87686275 CCCTAAGCAGAAATCACATGGCA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555794_1056555803 30 Left 1056555794 9:87686241-87686263 CCCGTTGGCTGACCCTAAGCAGA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555798_1056555803 17 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data
1056555799_1056555803 -7 Left 1056555799 9:87686278-87686300 CCAGCCTAGAGACACAATCCCTA No data
Right 1056555803 9:87686294-87686316 ATCCCTAGGACCAGCCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555803 Original CRISPR ATCCCTAGGACCAGCCACCC GGG Intronic