ID: 1056555807 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:87686302-87686324 |
Sequence | GACCAGCCACCCGGGCAACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056555798_1056555807 | 25 | Left | 1056555798 | 9:87686254-87686276 | CCTAAGCAGAAATCACATGGCAA | No data | ||
Right | 1056555807 | 9:87686302-87686324 | GACCAGCCACCCGGGCAACAGGG | No data | ||||
1056555797_1056555807 | 26 | Left | 1056555797 | 9:87686253-87686275 | CCCTAAGCAGAAATCACATGGCA | No data | ||
Right | 1056555807 | 9:87686302-87686324 | GACCAGCCACCCGGGCAACAGGG | No data | ||||
1056555799_1056555807 | 1 | Left | 1056555799 | 9:87686278-87686300 | CCAGCCTAGAGACACAATCCCTA | 0: 1 1: 0 2: 0 3: 6 4: 104 |
||
Right | 1056555807 | 9:87686302-87686324 | GACCAGCCACCCGGGCAACAGGG | No data | ||||
1056555801_1056555807 | -3 | Left | 1056555801 | 9:87686282-87686304 | CCTAGAGACACAATCCCTAGGAC | No data | ||
Right | 1056555807 | 9:87686302-87686324 | GACCAGCCACCCGGGCAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056555807 | Original CRISPR | GACCAGCCACCCGGGCAACA GGG | Intronic | ||