ID: 1056555809

View in Genome Browser
Species Human (GRCh38)
Location 9:87686305-87686327
Sequence CAGCCACCCGGGCAACAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056555797_1056555809 29 Left 1056555797 9:87686253-87686275 CCCTAAGCAGAAATCACATGGCA No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data
1056555798_1056555809 28 Left 1056555798 9:87686254-87686276 CCTAAGCAGAAATCACATGGCAA No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data
1056555801_1056555809 0 Left 1056555801 9:87686282-87686304 CCTAGAGACACAATCCCTAGGAC No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data
1056555799_1056555809 4 Left 1056555799 9:87686278-87686300 CCAGCCTAGAGACACAATCCCTA No data
Right 1056555809 9:87686305-87686327 CAGCCACCCGGGCAACAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056555809 Original CRISPR CAGCCACCCGGGCAACAGGG CGG Intronic